IL17E (IL25) (NM_022789) Human Untagged Clone
CAT#: SC305051
IL25 (untagged)-Human interleukin 25 (IL25), transcript variant 1
"NM_022789" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL25 |
Synonyms | IL17E |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_022789 edited
GGGAGGCCAAGCTGCCAGGTTTGGGGCTGGGGGCCAAGTGGAGTGAGAAACTGGGATCCC AGGGGGAGGGTGCAGATGAGGGAGCGACCCAGATTAGGTGAGGACAGTTCTCTCATTAGC CTTTTCCTACAGGTGGTTGCATTCTTGGCAATGGTCATGGGAACCCACACCTACAGCCAC TGGCCCAGCTGCTGCCCCAGCAAAGGGCAGGACACCTCTGAGGAGCTGCTGAGGTGGAGC ACTGTGCCTGTGCCTCCCCTAGAGCCTGCTAGGCCCAACCGCCACCCAGAGTCCTGTAGG GCCAGTGAAGATGGACCCCTCAACAGCAGGGCCATCTCCCCCTGGAGATATGAGTTGGAC AGAGACTTGAACCGGCTCCCCCAGGACCTGTACCACGCCCGTTGCCTGTGCCCGCACTGC GTCAGCCTACAGACAGGCTCCCACATGGACCCCCGGGGCAACTCGGAGCTGCTCTACCAC AACCAGACTGTCTTCTACAGGCGGCCATGCCATGGCGAGAAGGGCACCCACAAGGGCTAC TGCCTGGAGCGCAGGCTGTACCGTGTTTCCTTAGCTTGTGTGTGTGTGCGGCCCCGTGTG ATGGGCTAGCCGGACCTGCTGGAGGCTGGTCCCTTTTTGGGAAACCTGGAGCCAGGTGTA CAACCACTTGCCATGAAGGGCCAGGATGCCCAGATGCTTGGCCCCTGTGAAGTGCTGTCT GGAGCAGCAGGATCCCGGGACAGGATGGGGGGCTTTGGGGAAAACCTGCACTTCTGCACA TTTTGAAAAGAGCAGCTGCTGCTTAGGGCCGCCGGAAGCTGGTGTCCTGTCATTTTCTCT CAGGAAAGGTTTTCAAAGTTCTGCCCATTTCTGGAGGCCACCACTCCTGTCTCTTCC |
Restriction Sites | Please inquire |
ACCN | NM_022789 |
ORF Size | 534 bp |
Insert Size | 900 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a good match to NM_022789.2 except for one SNP. |
Reference Data | |
RefSeq | NM_022789.2, NP_073626.1 |
RefSeq Size | 1387 |
RefSeq ORF | 534 |
Locus ID | 64806 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes a longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210141 | IL25 (Myc-DDK-tagged)-Human interleukin 25 (IL25), transcript variant 1 |
USD 98.00 |
|
RG210141 | IL25 (GFP-tagged) - Human interleukin 25 (IL25), transcript variant 1 |
USD 460.00 |
|
RC210141L1 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC210141L2 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC210141L3 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC210141L4 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review