CDC25C (NM_022809) Human Untagged Clone

CAT#: SC305053

CDC25C (untagged)-Human cell division cycle 25 homolog C (S. pombe) (CDC25C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDC25C
• Synonyms: CDC25; PPP1R60
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022809, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTACGGAACTCTTCTCATCCACAAGAGAGGAAGGAAGCTCTGGCTCAGGACCCAGTTTTAGGTCTA
  ATCAAAGGAAAATGTTAAACCTGCTCCTGGAGAGAGACACTTCCTTTACCGTCTGTCCAGATGTCCCTAG
  AACTCCAGTGGGCAAATTTCTTGGTGATTCTGCAAACCTAAGCATTTTGTCTGGGTCACCTGGATTCTTC
  AGGACTTCAGGAAGTGCATTTAGCTGGGATGACAATGGAAACTTGGTGGACAGTGAAATGAAATATTTGG
  GCAGTCCCATTACTACTGTTCCAAAATTGGATAAAAATCCAAACCTAGGAGAAGACCAGGCAGAAGAGAT
  TTCAGATGAATTAATGGAGTTTTCCCTGAAAGATCAAGAAGCAAAGGTGAGCAGAAGTGGCCTATATCGC
  TCCCCGTCGATGCCAGAGAACTTGAACAGGCCAAGACTGAAGCAGGTGGAAAAATTCAAGGACAACACAA
  TACCAGATAAAGTTAAAAAAAAGTATTTTTCTGGCCAAGGAAAGCTCAGGAAGGGCTTATGTTTAAAGAA
  GACAGTCTCTCTGTGTGACATTACTATCACTCAGATGCTGGAGGAAGATTCTAACCAGGGGCACCTGATT
  GGTGATTTTTCCAAGGTATGTGCGCTGCCAACCGTGTCAGGGAAACACCAAGATCTGAAGTATGTCAACC
  CAGAAACAGTGGCTGCCTTACTGTCGGGGAAGTTCCAGGGTCTGATTGAGAAGTTTTATGTCATTGATTG
  TCGCTATCCATATGAGTATCTGGGAGGACACATCCAGGGAGCCTTAAACTTATATAGTCAGGAAGAACTG
  TTTAACTTCTTTCTGAAGAAGCCCATCGTCCCTTTGGACACCCAGAAGAGAATAATCATCGTGTTCCACT
  GTGAATTCTCCTCAGAGAGGGGCCCCCGAATGTGCCGCTGTCTGCGTGAAGAGGACAGGTCTCTGAACCA
  GTATCCTGCATTGTACTACCCAGAGCTATATATCCTTAAAGGCGGCTACAGAGACTTCTTTCCAGAATAT
  ATGGAACTGTGTGAACCACAGAGCTACTGCCCTATGCATCATCAGGACCACAAGACTGAGTTGCTGAGGT
  GTCGAAGCCAGAGCAAAGTGCAGGAAGGGGAGCGGCAGCTGCGGGAGCAGATTGCCCTTCTGGTGAAGGA
  CATGAGCCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022809
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022809.3, NP_073720.1
• RefSeq Size: 1972 bp
• RefSeq ORF: 1203 bp
• Locus ID: 995
• Cytogenetics: 5q31.2
• Protein Families: Druggable Genome, Phosphatase, Stem cell - Pluripotency
• Protein Pathways: Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation
• Gene Summary: 'This gene encodes a conserved protein that plays a key role in the regulation of cell division. The encoded protein directs dephosphorylation of cyclin B-bound CDC2 and triggers entry into mitosis. It also suppresses p53-induced growth arrest. Multiple alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Dec 2015]'
  Transcript Variant: This variant (2, also known as cdc25Cdm) lacks three exons in the 5' coding region, resulting in a short region of frameshift, compared to variant 4. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.