MRPL44 (NM_022915) Human Untagged Clone

CAT#: SC305065

MRPL44 (untagged)-Human mitochondrial ribosomal protein L44 (MRPL44), nuclear gene encoding mitochondrial protein


  "NM_022915" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRPL44"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRPL44
Synonyms COXPD16; L44MT; MRP-L44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_022915, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCCGGGCTGGTAAGATTGCTGCAGCAGGGACATCGCTGCCTCCTGGCTCCAGTCGCCCCCAAGC
TGGTCCCTCCGGTTCGGGGAGTGAAGAAGGGATTCCGCGCCGCCTTCCGCTTCCAGAAGGAGTTAGAGCG
GCAGCGCCTTCTGCGGTGCCCGCCGCCGCCCGTGCGCCGTTCAGAGAAGCCGAACTGGGATTACCATGCA
GAAATACAAGCTTTTGGACATCGGTTACAGGAAAACTTTTCCTTAGATCTTCTCAAAACTGCATTTGTTA
ATAGCTGCTATATTAAAAGTGAGGAGGCCAAACGCCAACAACTTGGGATAGAGAAAGAAGCTGTTCTTCT
GAATCTTAAAAGTAATCAAGAACTATCCGAACAAGGGACATCTTTTTCACAGACTTGCCTTACACAGTTT
CTTGAAGACGAGTACCCAGACATGCCCACTGAAGGCATAAAAAATCTTGTTGACTTTCTCACTGGTGAGG
AAGTCGTGTGTCACGTGGCTAGAAACTTGGCTGTGGAGCAGTTAACACTGAGTGAAGAATTCCCAGTGCC
CCCAGCTGTGTTACAGCAGACTTTCTTTGCAGTTATTGGAGCCCTGTTACAGAGCAGTGGACCTGAGAGG
ACTGCACTTTTCATCAGGGACTTCTTAATTACTCAAATGACTGGAAAAGAGCTCTTTGAGATGTGGAAGA
TAATAAATCCCATGGGGCTATTGGTAGAAGAACTGAAGAAAAGGAATGTTTCAGCTCCTGAATCAAGACT
TACTAGGCAGTCTGGTGGCACCACAGCTTTGCCTTTGTATTTTGTTGGCTTATACTGTGATAAAAAGTTG
ATTGCAGAAGGACCTGGGGAAACAGTATTGGTTGCAGAAGAAGAGGCTGCTCGAGTGGCCCTTAGAAAAC
TTTATGGATTCACAGAAAATAGACGGCCGTGGAACTATTCCAAGCCCAAAGAAACCTTGAGAGCAGAAAA
GAGCATCACTGCCAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_022915
ORF Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_022915.3, NP_075066.1
RefSeq Size 1772
RefSeq ORF 999
Locus ID 65080
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.