TAS2R10 (NM_023921) Human Untagged Clone

CAT#: SC305083

TAS2R10 (untagged)-Human taste receptor, type 2, member 10 (TAS2R10)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAS2R10
• Synonyms: T2R10; TRB2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_023921, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTACGTGTAGTGGAAGGCATCTTCATTTTTGTTGTAGTTAGTGAGTCAGTGTTTGGGGTTTTGGGGA
  ATGGATTTATTGGACTTGTAAACTGCATTGACTGTGCCAAGAATAAGTTATCTACGATTGGCTTTATTCT
  CACCGGCTTAGCTATTTCAAGAATTTTTCTGATATGGATAATAATTACAGATGGATTTATACAGATATTC
  TCTCCAAATATATATGCCTCCGGTAACCTAATTGAATATATTAGTTACTTTTGGGTAATTGGTAATCAAT
  CAAGTATGTGGTTTGCCACCAGCCTCAGCATCTTCTATTTCCTGAAGATAGCAAATTTTTCCAACTACAT
  ATTTCTCTGGTTGAAGAGCAGAACAAATATGGTTCTTCCCTTCATGATAGTATTCTTACTTATTTCATCG
  TTACTTAATTTTGCATACATTGCGAAGATTCTTAATGATTATAAAACGAAGAATGACACAGTCTGGGATC
  TCAACATGTATAAAAGTGAATACTTTATTAAACAGATTTTGCTAAATCTGGGAGTCATTTTCTTCTTTAC
  ACTATCCCTAATTACATGTATTTTTTTAATCATTTCCCTTTGGAGACACAACAGGCAGATGCAATCGAAT
  GTGACAGGATTGAGAGACTCCAACACAGAAGCTCATGTGAAGGCAATGAAAGTTTTGATATCTTTCATCA
  TCCTCTTTATCTTGTATTTTATAGGCATGGCCATAGAAATATCATGTTTTACTGTGCGAGAAAACAAACT
  GCTGCTTATGTTTGGAATGACAACCACAGCCATCTATCCCTGGGGTCACTCATTTATCTTAATTCTAGGA
  AACAGCAAGCTAAAGCAAGCCTCTTTGAGGGTACTGCAGCAATTGAAGTGCTGTGAGAAAAGGAAAAATC
  TCAGAGTCACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_023921
• ORF Size: 924 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_023921.1, NP_076410.1
• RefSeq Size: 924
• RefSeq ORF: 924
• Locus ID: 50839
• Protein Families: Transmembrane
• Protein Pathways: Taste transduction
• Gene Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]