TAS2R10 (NM_023921) Human Untagged Clone
CAT#: SC305083
TAS2R10 (untagged)-Human taste receptor, type 2, member 10 (TAS2R10)
"NM_023921" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAS2R10 |
Synonyms | T2R10; TRB2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_023921, the custom clone sequence may differ by one or more nucleotides
ATGCTACGTGTAGTGGAAGGCATCTTCATTTTTGTTGTAGTTAGTGAGTCAGTGTTTGGGGTTTTGGGGA ATGGATTTATTGGACTTGTAAACTGCATTGACTGTGCCAAGAATAAGTTATCTACGATTGGCTTTATTCT CACCGGCTTAGCTATTTCAAGAATTTTTCTGATATGGATAATAATTACAGATGGATTTATACAGATATTC TCTCCAAATATATATGCCTCCGGTAACCTAATTGAATATATTAGTTACTTTTGGGTAATTGGTAATCAAT CAAGTATGTGGTTTGCCACCAGCCTCAGCATCTTCTATTTCCTGAAGATAGCAAATTTTTCCAACTACAT ATTTCTCTGGTTGAAGAGCAGAACAAATATGGTTCTTCCCTTCATGATAGTATTCTTACTTATTTCATCG TTACTTAATTTTGCATACATTGCGAAGATTCTTAATGATTATAAAACGAAGAATGACACAGTCTGGGATC TCAACATGTATAAAAGTGAATACTTTATTAAACAGATTTTGCTAAATCTGGGAGTCATTTTCTTCTTTAC ACTATCCCTAATTACATGTATTTTTTTAATCATTTCCCTTTGGAGACACAACAGGCAGATGCAATCGAAT GTGACAGGATTGAGAGACTCCAACACAGAAGCTCATGTGAAGGCAATGAAAGTTTTGATATCTTTCATCA TCCTCTTTATCTTGTATTTTATAGGCATGGCCATAGAAATATCATGTTTTACTGTGCGAGAAAACAAACT GCTGCTTATGTTTGGAATGACAACCACAGCCATCTATCCCTGGGGTCACTCATTTATCTTAATTCTAGGA AACAGCAAGCTAAAGCAAGCCTCTTTGAGGGTACTGCAGCAATTGAAGTGCTGTGAGAAAAGGAAAAATC TCAGAGTCACATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_023921 |
ORF Size | 924 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_023921.1, NP_076410.1 |
RefSeq Size | 924 |
RefSeq ORF | 924 |
Locus ID | 50839 |
Protein Families | Transmembrane |
Protein Pathways | Taste transduction |
Gene Summary | This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218991 | TAS2R10 (Myc-DDK-tagged)-Human taste receptor, type 2, member 10 (TAS2R10) |
USD 420.00 |
|
RG218991 | TAS2R10 (GFP-tagged) - Human taste receptor, type 2, member 10 (TAS2R10) |
USD 460.00 |
|
RC218991L1 | Lenti ORF clone of Human taste receptor, type 2, member 10 (TAS2R10), Myc-DDK-tagged |
USD 620.00 |
|
RC218991L2 | Lenti ORF clone of Human taste receptor, type 2, member 10 (TAS2R10), mGFP tagged |
USD 620.00 |
|
RC218991L3 | Lenti ORF clone of Human taste receptor, type 2, member 10 (TAS2R10), Myc-DDK-tagged |
USD 620.00 |
|
RC218991L4 | Lenti ORF clone of Human taste receptor, type 2, member 10 (TAS2R10), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review