ADM2 (NM_024866) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADM2 |
Synonyms | AM2; dJ579N16.4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_024866 edited
CCGCCCGCCATGGCCCGGATCCCGACGGCCGCCCTGGGTTGCATCAGCCTCCTCTGCCTG CAGCTCCCTGGCTCGCTGTCCCGCAGCCTGGGCGGGGACCCGCGACCCGTCAAACCCAGG GAGCCCCCAGCCCGGAGCCCTTCCAGCAGCCTGCAGCCCAGGCACCCCGCACCCCGACCT GTGGTCTGGAAGCTTCACCGGGCCCTCCAGGCACAGAGGGGTGCCGGCCTGGCCCCTGTT ATGGGTCAGCCTCTCCGGGATGGTGGCCGCCAACACTCGGGCCCCCGAAGACACTCGGGC CCCCGCAGGACCCAAGCCCAGCTCCTGCGAGTGGGCTGTGTGCTGGGCACCTGCCAGGTG CAGAATCTCAGCCACCGCCTGTGGCAACTCATGGGACCGGCCGGCCGGCAGGACTCAGCT CCTGTGGACCCCAGCAGCCCCCACAGCTATGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_024866 |
ORF Size | 447 bp |
Insert Size | 456 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It is not a varient. |
Reference Data | |
RefSeq | NM_024866.3, NP_079142.2 |
RefSeq Size | 4063 |
RefSeq ORF | 447 |
Locus ID | 79924 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis, prolactin release, anti-diuresis, anti-natriuresis, and regulation of food and water intake. The encoded protein is proteolytically processed to generate one or more biologically active peptides. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216633 | ADM2 (Myc-DDK-tagged)-Human adrenomedullin 2 (ADM2) |
USD 98.00 |
|
RG216633 | ADM2 (GFP-tagged) - Human adrenomedullin 2 (ADM2) |
USD 460.00 |
|
RC216633L1 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), Myc-DDK-tagged |
USD 768.00 |
|
RC216633L2 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), mGFP tagged |
USD 620.00 |
|
RC216633L3 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), Myc-DDK-tagged |
USD 620.00 |
|
RC216633L4 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review