CXXC4 (NM_025212) Human Untagged Clone

CAT#: SC305244

CXXC4 (untagged)-Human CXXC finger protein 4 (CXXC4)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CXXC4
• Synonyms: IDAX
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_025212 edited
  ATGCACCACCGAAACGACTCCCAGAGGCTGGGGAAAGCTGGCTGCCCGCCAGAGCCGTCG
  TTGCAAATGGCAAATACTAATTTCCTCTCCACCTTATCCCCTGAACACTGCAGACCTTTG
  GCGGGGGAATGCATGAACAAGCTCAAATGCGGCGCTGCTGAAGCAGAGATAATGAATCTC
  CCCGAGCGCGTGGGGACTTTTTCCGCTATCCCGGCTTTAGGGGGCATCTCATTACCTCCA
  GGGGTCATCGTCATGACAGCCCTTCACTCCCCCGCAGCAGCCTCAGCAGCCGTCACAGAC
  AGTGCGTTTCAAATTGCCAATCTGGCAGACTGCCCGCAGAATCATTCCTCCTCCTCCTCG
  TCCTCCTCAGGGGGAGCTGGCGGAGCCAACCCAGCCAAGAAGAAGAGGAAAAGGTGTGGG
  GTCTGCGTGCCCTGCAAGAGGCTCATCAACTGTGGCGTCTGCAGCAGTTGCAGGAACCGC
  AAAACGGGACACCAGATCTGCAAATTTAGAAAATGTGAAGAGCTAAAGAAAAAACCTGGC
  ACTTCACTAGAGAGAACACCTGTTCCCAGCGCTGAAGCATTCCGATGGTTCTTTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_025212
• ORF Size: 597 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_025212.1, NP_079488.1
• RefSeq Size: 761
• RefSeq ORF: 597
• Locus ID: 80319
• Protein Families: Druggable Genome
• Protein Pathways: Wnt signaling pathway
• Gene Summary: This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.