CSP (DNAJC5) (NM_025219) Human Untagged Clone

CAT#: SC305246

DNAJC5 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5)


  "NM_025219" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "DNAJC5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJC5
Synonyms CLN4; CLN4B; CSP; DNAJC5A; mir-941-2; mir-941-3; mir-941-4; mir-941-5; NCL
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_025219 edited
AGCCTAACATGGCAGACCAGAGACAGCGCTCACTGTCTACCTCTGGGGAGTCATTGTACC
ACGTCCTTGGGTTGGACAAGAACGCAACCTCAGATGACATTAAAAAGTCCTATCGGAAGC
TTGCCTTGAAATATCACCCCGACAAGAACCCCGACAACCCGGAGGCCGCGGACAAGTTTA
AGGAGATCAACAACGCGCACGCCATCCTCACGGACGCCACAAAAAGGAACATCTACGACA
AGTACGGCTCGCTGGGTCTCTACGTGGCCGAGCAGTTTGGGGAAGAGAACGTGAACACCT
ACTTCGTGCTGTCCAGCTGGTGGGCCAAGGCCCTGTTTGTCTTCTGCGGCCTCCTCACGT
GCTGCTACTGCTGCTGCTGTCTGTGCTGCTGCTTCAACTGCTGCTGCGGGAAGTGTAAGC
CCAAGGCGCCTGAAGGCGAGGAGACGGAGTTCTACGTGTCCCCCGAGGATCTGGAGGCAC
AGCTGCAGTCTGACGAGAGGGAGGCCACAGACACGCCGATCGTCATACAGCCGGCATCCG
CCACCGAGACCACCCAGCTCACAGCCGACTCCCACCCCAGCTACCACACTGACGGGTTCA
ACTAAATCCAGGAGGAGCTGTGGTC
Restriction Sites Please inquire     
ACCN NM_025219
ORF Size 597 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_025219.1, NP_079495.1
RefSeq Size 3286
RefSeq ORF 597
Locus ID 80331
Protein Families Transmembrane
Gene Summary This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.