CSP (DNAJC5) (NM_025219) Human Untagged Clone
CAT#: SC305246
DNAJC5 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5)
"NM_025219" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DNAJC5 |
Synonyms | CLN4; CLN4B; CSP; DNAJC5A; mir-941-2; mir-941-3; mir-941-4; mir-941-5; NCL |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_025219 edited
AGCCTAACATGGCAGACCAGAGACAGCGCTCACTGTCTACCTCTGGGGAGTCATTGTACC ACGTCCTTGGGTTGGACAAGAACGCAACCTCAGATGACATTAAAAAGTCCTATCGGAAGC TTGCCTTGAAATATCACCCCGACAAGAACCCCGACAACCCGGAGGCCGCGGACAAGTTTA AGGAGATCAACAACGCGCACGCCATCCTCACGGACGCCACAAAAAGGAACATCTACGACA AGTACGGCTCGCTGGGTCTCTACGTGGCCGAGCAGTTTGGGGAAGAGAACGTGAACACCT ACTTCGTGCTGTCCAGCTGGTGGGCCAAGGCCCTGTTTGTCTTCTGCGGCCTCCTCACGT GCTGCTACTGCTGCTGCTGTCTGTGCTGCTGCTTCAACTGCTGCTGCGGGAAGTGTAAGC CCAAGGCGCCTGAAGGCGAGGAGACGGAGTTCTACGTGTCCCCCGAGGATCTGGAGGCAC AGCTGCAGTCTGACGAGAGGGAGGCCACAGACACGCCGATCGTCATACAGCCGGCATCCG CCACCGAGACCACCCAGCTCACAGCCGACTCCCACCCCAGCTACCACACTGACGGGTTCA ACTAAATCCAGGAGGAGCTGTGGTC |
Restriction Sites | Please inquire |
ACCN | NM_025219 |
ORF Size | 597 bp |
Insert Size | 700 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_025219.1, NP_079495.1 |
RefSeq Size | 3286 |
RefSeq ORF | 597 |
Locus ID | 80331 |
Protein Families | Transmembrane |
Gene Summary | This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208826 | DNAJC5 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5) |
USD 98.00 |
|
RG208826 | DNAJC5 (GFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5) |
USD 460.00 |
|
RC208826L1 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), Myc-DDK-tagged |
USD 768.00 |
|
RC208826L2 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mGFP tagged |
USD 620.00 |
|
RC208826L3 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), Myc-DDK-tagged |
USD 620.00 |
|
RC208826L4 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review