LY6G5C (NM_025262) Human Untagged Clone

CAT#: SC305259

LY6G5C (untagged)-Human lymphocyte antigen 6 complex, locus G5C (LY6G5C)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LY6G5C
• Synonyms: C6orf20; G5C; LY6G5CA; LY6G5CB; NG33
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_025262, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTTTTATGGCAGGCCCTGCAGGGAGCCAGAGTCTGGGTCCCCTGTGCTTCCACAGCAGCCCCCAAG
  CCCTCTACACGGTCCTCTTAATAGTGCTGGTCATGATGAGCTTGGTGTTTGGTAAGTTTGTTCCTGTCAA
  TTGGGAACCCCCTCAACCACTTCCATTCCCCAAATACCTGCGCTGCTACCGATGCCTCTTGGAGACCAAG
  GAGTTAGGGTGCCTTCTGGGATCTGACATCTGCCTCACCCCAGCTGGCAGCAGCTGCATCACTCTCCACA
  AAAAGAACAGCAGCGGTTCTGACGTCATGGTGAGTGACTGCCGAAGTAAGGAGCAGATGAGTGATTGTTC
  AAATACCCGAACTTCTCCGGTGTCTGGCTTCTGGATATTCTCTCAATACTGCTTCCTGGATTTCTGCAAT
  GACCCTCAAAACAGAGGGCTCTATACTCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_025262
• ORF Size: 453 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_025262.3, NP_079538.3
• RefSeq Size: 738
• RefSeq ORF: 453
• Locus ID: 80741
• Protein Families: Transmembrane
• Gene Summary: LY6G5C belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (3) encodes the longest isoform (B).