SLC25A21 (NM_030631) Human Untagged Clone

CAT#: SC305275

SLC25A21 (untagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 1


  "NM_030631" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC25A21"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC25A21
Synonyms ODC; ODC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_030631, the custom clone sequence may differ by one or more nucleotides


ATGTCCGCCAAGCCTGAAGTCAGCTTAGTGCGCGAGGCTTCTCGGCAGATCGTGGCCGGTGGTTCTGCAG
GTCTTGTAGAAATTTGCCTGATGCACCCCCTAGATGTGGTGAAAACCAGGTTTCAGATTCAGAGATGTGC
AACCGATCCAAACAGTTATAAAAGCTTGGTAGACAGCTTTCGAATGATTTTCCAAATGGAAGGGTTATTT
GGTTTTTACAAGGGAATTCTGCCACCTATCTTGGCTGAAACCCCAAAAAGAGCAGTGAAGTTTTTCACCT
TTGAGCAGTACAAGAAATTGCTGGGATATGTGTCACTGTCACCAGCATTGACATTCGCCATTGCTGGATT
GGGATCTGGACTAACAGAAGCCATTGTAGTTAACCCTTTTGAGGTAGTAAAAGTTGGCTTGCAAGCAAAT
CGGAACACATTTGCAGAGCAACCATCCACTGTGGGTTATGCAAGACAAATCATTAAGAAGGAAGGCTGGG
GACTCCAGGGCCTCAACAAAGGATTAACTGCAACTTTGGGACGACATGGAGTTTTCAACATGGTTTATTT
TGGCTTCTACTACAATGTCAAAAACATGATTCCTGTCAATAAGGATCCAATCTTGGAGTTTTGGAGAAAA
TTTGGGATTGGTCTTCTCTCGGGGACAATAGCCTCAGTCATTAACATCCCTTTTGATGTTGCCAAAAGTA
GGATTCAAGGGCCTCAACCAGTTCCTGGAGAGATCAAGTACAGAACCTGTTTTAAAACAATGGCAACAGT
CTATCAGGAAGAAGGGATTTTAGCTTTGTACAAAGGCCTGCTTCCCAAGATTATGAGACTTGGACCAGGT
GGTGCAGTGATGCTGCTGGTTTATGAATACACCTATTCATGGCTTCAAGAGAACTGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_030631
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_030631.3, NP_085134.1
RefSeq Size 3947
RefSeq ORF 900
Locus ID 89874
Gene Summary SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA. [supplied by OMIM, Apr 2004]
Transcript Variant: This variant (1) is the longer transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.