WNT8A (NM_031933) Human Untagged Clone
CAT#: SC305368
WNT8A (untagged)-Human wingless-type MMTV integration site family, member 8A (WNT8A), transcript variant 1
Product Images
Other products for "WNT8A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WNT8A |
Synonyms | OTTHUMP00000180556; wingless-type MMTV integration site family, member 8A; WNT8D |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_031933 edited
GGTACCGATCGCCATGGGGAACCTGTTTATGCTCTGGGCAGCTCTGGGCATATGCTGTGC TGCATTCAGTGCCTCTGCCTGGTCAGTGAACAATTTCCTGATAACAGGTCCCAAGGCCTA TCTGACCTACACGACTAGTGTGGCCTTGGGTGCCCAGAGTGGCATCGAGGAGTGCAAGTT CCAGTTTGCTTGGGAACGCTGGAACTGCCCTGAAAATGCTCTTCAGCTCTCCACCCACAA CAGGCTGAGAAGTGCTACCAGAGAGACTTCCTTCATACATGCTATCAGCTCTGCTGGAGT CATGTACATCATCACCAAGAACTGTAGCATGGGTGACTTCGAAAACTGTGGCTGTGATGG GTCAAACAATGGAAAAACAGGAGGCCATGGCTGGATCTGGGGAGGCTGCAGCGACAATGT GGAATTTGGGGAAAGGATCTCCAAACTCTTTGTGGACAGTTTGGAGAAGGGGAAGGATGC CAGAGCCCTGATGAATCTTCACAACAACAGGGCCGGCAGACTGGCAGTGAGAGCCACCAT GAAAAGGACATGCAAATGTCATGGCATCTCTGGGAGCTGCAGCATACAGACATGCTGGCT GCAGCTGGCTGAATTCCGGGAGATGGGAGACTACCTAAAGGCCAAGTATGACCAGGCGCT GAAAATTGAAATGGATAAGCGGCAGCTGAGAGCTGGGAACAGCGCCGAGGGCCACTGGGT GCCCGCTGAGGCCTTCCTTCCTAGCGCAGAGGCGGAACTGATCTTTTTAGAGGAATCACC AGATTACTGTACCTGCAATTCCAGCCTGGGCATCTATGGCACAGAGGGTCGTGAGTGCCT ACAGAACAGCCACAACACATCCAGGTGGGAGCGACGTAGCTGTGGGCGCCTGTGCACTGA GTGTGGGCTGCAGGTGGAAGAGAGGAAAACTGAGGTCATAAGCAGCTGTAACTGCAAATT CCAGTGGTGCTGTACGGTCAAGTGTGACCAGTGTAGGCATGTGGTGAGCAAGTATTACTG CGCACGCTCCCCAGGCAGTGCCCAGTCCCTGGGGAGAGTTTGGTTTGGGGTCTATATCTA GCTCGAGCAGAAACTCATCTCAGAAGAGTCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_031933 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_031933.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031933.1, NP_114139.1 |
RefSeq Size | 1597 bp |
RefSeq ORF | 1068 bp |
Locus ID | 7478 |
Cytogenetics | 5q31.2 |
Protein Families | Cancer stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Gene Summary | 'The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (1) lacks an internal fragment and encodes a longer isoform with distinct C-terminus, as compared to variant 2. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.