KCNK16 (NM_032115) Human Untagged Clone
CAT#: SC305399
KCNK16 (untagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2
"NM_032115" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNK16 |
Synonyms | K2p16.1; TALK-1; TALK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032115, the custom clone sequence may differ by one or more nucleotides
ATGCCCAGTGCTGGGCTCTGCAGCTGCTGGGGTGGCCGGGTGCTGCCCCTGCTGCTGGCCTATGTCTGCT ACCTGCTGCTCGGTGCCACTATCTTCCAGCTGCTAGAGAGGCAGGCGGAGGCTCAGTCCAGGGACCAGTT TCAGTTGGAGAAGCTGCGCTTCCTGGAGAACTACACCTGCCTGGACCAGTGGGCCATGGAGCAGTTTGTG CAGGTCATCATGGAAGCCTGGGTGAAAGGTGTGAACCCCAAAGGCAACTCTACCAACCCCAGCAACTGGG ACTTTGGCAGCAGTTTCTTCTTTGCAGGCACAGTCGTCACTACCATAGGATATGGGAACCTGGCACCCAG CACAGAGGCAGGTCAGGTCTTCTGTGTCTTCTATGCCCTGTTGGGCATCCCGCTTAACGTGATCTTCCTC AACCACCTGGGCACAGGGCTGCGTGCCCATCTGGCCGCCATTGAAAGATGGGAGGACCGTCCCAGGCGCT CCCAGGTACTGCAAGTCCTGGGCCTGGCTCTGTTCCTGACCCTGGGGACGCTGGTCATTCTCATCTTCCC ACCCATGGTCTTCAGCCATGTGGAGGGCTGGAGCTTCAGCGAGGGCTTCTACTTTGCTTTCATCACTCTC AGCACCATTGGCTTTGGGGACTATGTTGTTGGCACAGACCCCAGCAAGCATTATATCTCAGTGTATCGGA GCCTGGCAGCCATCTGGATCCTCCTGGGCCTGGCGTGGCTGGCGCTGATCCTCCCACTGGGCCCCCTGCT TCTGCACAGATGCTGCCAGCTCTGGCTGCTCAGTCTGAGGCAAGGCTGTGGAGCCAAGGCGGCTCCAGGC AGGAGACCCAGGAGAGGCTCTACAGCAGCAAGAGGAGTCCAAGTCACACCCCAGGACTTCCCCATATCCA AGAAAGGACTGGGAAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_032115 |
ORF Size | 930 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_032115.2, NP_115491.1 |
RefSeq Size | 1226 |
RefSeq ORF | 930 |
Locus ID | 83795 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (2, also known as TALK-1a) contains an additional coding exon and uses a different acceptor splice site at the 3' terminal exon compared to transcript variant 1, resulting in a shorter isoform (2) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224694 | KCNK16 (Myc-DDK-tagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2 |
USD 420.00 |
|
RG224694 | KCNK16 (GFP-tagged) - Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2 |
USD 460.00 |
|
RC224694L1 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC224694L2 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC224694L3 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC224694L4 | Lenti ORF clone of Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review