SPANXD (NM_032417) Human Untagged Clone

CAT#: SC305442

SPANXD (untagged)-Human SPANX family, member D (SPANXD)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPANXD
• Synonyms: CT11.3; CT11.4; dJ171K16.1; SPANX-C; SPANX-D; SPANX-E; SPANXC; SPANXE
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032417, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCGTCCCCTGTGATTCCAACGAGGCCAACGAGA
  TGATGCCGGAGACCTCGAGTGGGTACTCAGACCCGCAACCTGCTCCGAAAAAACTAAAAACATCTGAGTC
  CTCGACCATACTAGTGGTTCGCTACAGGAGGAACTTTAAAAGAACATCTCCAGAGGAACTGGTGAATGAC
  CACGCCCGAAAGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAA
  TACCTGCAAAGTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_032417
• ORF Size: 294 bp
• Insert Size: 500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: It was fully sequenced and the DNA sequence matches with that of NM_032417.2.There are a few SNPs in ORF.

Reference Data

• RefSeq: NM_032417.2, NP_115793.1
• RefSeq Size: 384
• RefSeq ORF: 294
• Locus ID: 64648
• Gene Summary: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a sperm protein that is associated with the nucleus but, although a role in spermatogenesis is suggested, the specific function of this family member has not yet been determined. Polymorphisms in this gene may be associated with prostate cancer susceptibility. [provided by RefSeq, Apr 2014]