PPIL3 (NM_032472) Human Untagged Clone

CAT#: SC305456

PPIL3 (untagged)-Human peptidylprolyl isomerase (cyclophilin)-like 3 (PPIL3), transcript variant PPIL3a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPIL3
• Synonyms: CYPJ
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032472, the custom clone sequence may differ by one or more nucleotides
  ATGTCTGTGACACTGCATACAGATGTAGGTGATATTAAAATTGAAGTCTTCTGTGAGAGG
  ACACCCAAAACATGTGAGATGGAGTCTCGCTGTGTCCCCCAGGCTGGAGTACAATGGCGC
  GATCTCGGCTCACTGCAACCTCCGCCTCCTGGGTTCAAGCAAGTCTTCTGCCTCAGCCTC
  CCGAGAACTGGAAGAGGAGGCAACAGTATTTGGGGCAAGAAGTTTGAGGATGAATACAGT
  GAATATCTTAAGCACAATGTTAGAGGTGTTGTATCTATGGCTAATAATGGCCCGAACACC
  AATGGATCTCAGTTCTTCATCACCTATGGCAAACAGCCACATTTGGACATGAAATACACC
  GTATTTGGAAAGGTAATAGATGGTCTGGAAACTCTAGATGAGTTGGAGAAGTTGCCAGTA
  AATGAGAAGACATACCGACCTCTTAATGATGTACACATTAAGGACATAACTATTCATGCC
  AACCCATTTGCTCAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_032472
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032472.3, NP_115861.1
• RefSeq Size: 1191
• RefSeq ORF: 498
• Locus ID: 53938
• Gene Summary: This gene encodes a member of the cyclophilin family. Cyclophilins catalyze the cis-trans isomerization of peptidylprolyl imide bonds in oligopeptides. They have been proposed to act either as catalysts or as molecular chaperones in protein-folding events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2008]
  Transcript Variant: This variant (PPIL3a) encodes the longer isoform (PPIL3a).