SPINK7 (NM_032566) Human Untagged Clone

CAT#: SC305476

SPINK7 (untagged)-Human serine peptidase inhibitor, Kazal type 7 (putative) (SPINK7)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPINK7
• Synonyms: ECG2; ECRG2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032566, the custom clone sequence may differ by one or more nucleotides
  ATGAAGATCACTGGGGGTCTCCTTCTGCTCTGTACAGTGGTCTATTTCTGTAGCAGCTCA
  GAAGCTGCTAGTCTGTCTCCAAAAAAAGTGGACTGCAGCATTTACAAGAAGTATCCAGTG
  GTGGCCATCCCCTGCCCCATCACATACCTACCAGTTTGTGGTTCTGACTACATCACCTAT
  GGGAATGAATGTCACTTGTGTACCGAGAGCTTGAAAAGTAATGGAAGAGTTCAGTTTCTT
  CACGATGGAAGTTGCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_032566
• ORF Size: 258 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032566.2, NP_115955.1
• RefSeq Size: 566
• RefSeq ORF: 258
• Locus ID: 84651
• Protein Families: Secreted Protein
• Gene Summary: Probable serine protease inhibitor. [UniProtKB/Swiss-Prot Function]