Ovary specific acidic protein (MGARP) (NM_032623) Human Untagged Clone

CAT#: SC305491

MGARP (untagged)-Human chromosome 4 open reading frame 49 (C4orf49)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MGARP
• Synonyms: C4orf49; CESP-1; HUMMR; OSAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032623, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTATCTCCGCAGGGCGGTCTCCAAGACTCTGGCGCTGCCGCTGAGGGCGCCCCCCAACCCCGCGCCGC
  TCGGAAAGGACGCATCTCTGCGCCGGATGTCATCTAACAGATTCCCTGGATCATCTGGATCAAATATGAT
  TTATTATCTGGTTGTAGGCGTCACAGTCAGTGCTGGTGGATATTATGCTTACAAGACAGTCACATCAGAC
  CAAGCCAAACACACAGAACATAAAACAAATTTGAAAGAAAAAACAAAAGCAGAGATACATCCATTTCAAG
  GTGAAAAGGAGAATGTTGCGGAAACTGAGAAAGCAAGTTCAGAAGCCCCAGAAGAACTTATAGTGGAAGC
  TGAGGTGGTAGATGCTGAAGAAAGTCCCAGTGCTACAGTTGTGGTCATAAAAGAGGCATCTGCCTGTCCA
  GGTCACGTGGAGGCTGCTCCGGAGACCACAGCAGTCAGTGCTGAAACCGGGCCAGAGGTCACAGATGCAG
  CGGCGAGGGAAACCACGGAAGTAAACCCTGAAACAACCCCAGAGGTTACAAATGCTGCCCTGGATGAAGC
  TGTCACCATCGATAATGATAAAGATACAACAAAGAACGAAACCTCTGATGAATATGCTGAACTAGAAGAA
  GAAAATTCTCCAGCTGAGTCAGAGTCCTCTGCTGGAGATGATTTACAGGAGGAAGCCAGTGTTGGCTCTG
  AGGCTGCTTCGGCTCAAGGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032623
• ORF Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032623.3, NP_116012.2
• RefSeq Size: 1339
• RefSeq ORF: 723
• Locus ID: 84709
• Protein Families: Transmembrane
• Gene Summary: Plays a role in the trafficking of mitochondria along microtubules. Regulates the kinesin-mediated axonal transport of mitochondria to nerve terminals along microtubules during hypoxia. Participates in the translocation of TRAK2/GRIF1 from the cytoplasm to the mitochondrion. Also plays a role in steroidogenesis through maintenance of mitochondrial abundance and morphology. [UniProtKB/Swiss-Prot Function]