Caspase 9 (CASP9) (NM_032996) Human Untagged Clone

CAT#: SC305531

CASP9 (untagged)-Human caspase 9, apoptosis-related cysteine peptidase (CASP9), transcript variant beta


  "NM_032996" in other vectors (6)

Reconstitution Protocol

USD 660.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CASP9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CASP9
Synonyms APAF-3; APAF3; ICE-LAP6; MCH6; PPP1R56
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_032996 edited
CTGGCTGCGCGTTTGGCTGCAATGAGCTCGGCCTCGGGGCTCCGCAGGGGGCACCCGGCA
GTGTCAACTGTTAGCCACGCAGATGCCGATTGCTTTGTGTGTGTCTTCCTGAGCCATGGC
GAAGGCAATCACATTTATGCATATGATGCTAAAATCGAAATTCAGACATTAACTGGCTTG
TTCAAAGGAGACAAGTGTCACAGCCTGGTTGGAAAACCCAAGATATTTATCATTCAGGCA
TGTCGGGGAAACCAGCACGATGTGCCAGTCATTCCTTTGGATGTAGTAGATAATCAGACA
GAGAAGTTGGACACCAACATAACTGAGGTGGATGCAGCCTCCGTTTACACGCTGCCTGCT
GGAGCTGACTTCCTCATGTGTTACTCTGTTGCAGAAGGATATTATTCTCACCGGGAAACT
GTGAACGGCTCATGGTACATTCAAGATTTGTGTGAGATGTTGGGAAAATATGGCTCCTCC
TTAGAGTTCACAGAACTCCTCACACTGGTGAACAGGAAAGTTTCTCAGCGCCGAGTGGAC
TTTTGCAAAGACCCAAGTGCAATTGGAAAGAAGCAGGTTCCCTGTTTTGCCTCAATGCTA
ACTAAAAAGCTGCATTTCTTTCCAAAATCTAATTAATTAATAGAGGCTATCTAATTTTAC
ACTCTGTATTGAAAATGGCTTTCTCAGCCAGGCGTGGTTACTCACACCTGTAATCCCAGC
ACTTTGGGAGTCCAAGGTGGGCGGATCACCTGAGGTCGGGAGTTCGAGACCAGCCTGACC
AACATGGAGAAGCCCCGTCTCTACTAAAAATGCAAAAAAAAATTTAGCTAGGCATGGCGG
CGCATGCCTGCAATCCCAGCTACTTGGAAGGCTGAGGCAGGAGAATCACTTGAACCCAGG
AGGTGGAGGCTGCGGTGAGCCGAGATTGCGCCATTGCACTCCAGCCTGGGCAACGAGTGA
AACTCCGTCTCAAAAAAAAGAAAATGTCTTTCTCTTCCTTTTATATAAATATCGTTAGGG
TGAAGCATTATGGTCCAATGATTCAAATGTTTTAAAGTTTAATGCCTAGCAGAGAAGAGA
ACTGCCTTAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_032996
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032996.1, NP_127463.1
RefSeq Size 1584 bp
RefSeq ORF 801 bp
Locus ID 842
Cytogenetics 1p36.21
Protein Families Druggable Genome, Protease, Stem cell - Pluripotency
Protein Pathways Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Endometrial cancer, Huntington's disease, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Parkinson's disease, Pathways in cancer, Prostate cancer, Small cell lung cancer, VEGF signaling pathway, Viral myocarditis
Gene Summary 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein can undergo autoproteolytic processing and activation by the apoptosome, a protein complex of cytochrome c and the apoptotic peptidase activating factor 1; this step is thought to be one of the earliest in the caspase activation cascade. This protein is thought to play a central role in apoptosis and to be a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]'
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant alpha. The encoded isoform (3) has a shorter N-terminus, compared to isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.