PDGF beta (PDGFB) (NM_033016) Human Untagged Clone

CAT#: SC305533

PDGFB (untagged)-Human platelet-derived growth factor beta polypeptide (PDGFB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDGFB
• Synonyms: c-sis; IBGC5; PDGF-2; PDGF2; SIS; SSV
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033016, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTATCATGGGCCTCGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCC
  GCTCCTTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCT
  GAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGTTCC
  CTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCACCGAGGTGTTCGAGATCTCCCGGC
  GCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCGG
  CTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAG
  ATCGAGATTGTGCGGAAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCA
  AGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAGCGAGCCAA
  AACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGGGCAAGCACCGGAAA
  TTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033016
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033016.3, NP_148937.1
• RefSeq Size: 2701 bp
• RefSeq ORF: 681 bp
• Locus ID: 5155
• Cytogenetics: 22q13.1
• Protein Families: Druggable Genome
• Protein Pathways: Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Glioma, MAPK signaling pathway, Melanoma, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma
• Gene Summary: 'This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]'
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon, resulting in the use of an alternate start codon compared to variant (1). The encoded isoform (2) has a shorter and distinct N-terminus, and lacks a signal peptide compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform (1). CCDS Note: This CCDS representation is based on X83705.1. Although this mRNA accession lacks the final two exons, data in PMID:7659502 support the full-length nature of the transcript, and also the presence of a functional promoter at the 5' end.