FGF8 (NM_033163) Human Untagged Clone

CAT#: SC305580

FGF8 (untagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant F

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF8
• Synonyms: AIGF; FGF-8; HBGF-8; HH6; KAL6
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_033163 edited
  CGGAGCCGCGCGCCATGGGCAGCCCCCGCTCCGCGCTGAGCTGCCTGCTGTTGCACTTGC
  TGGTCCTCTGCCTCCAAGCCCAGGAAGGCCCGGGCAGGGGCCCTGCGCTGGGCAGGGAGC
  TCGCTTCCCTGTTCCGGGCTGGCCGGGAGCCCCAGGGTGTCTCCCAACAGGTAACTGTTC
  AGTCCTCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACGGATCAGCTCA
  GCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGGAAGCACGTGCAGG
  TCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCCTTCGCAAAGCTCA
  TCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCCGAGACGGGCCTCT
  ACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGCAAAGGCAAGGACT
  GCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAGAATGCCAAGTACG
  AGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGACGCGGC
  AGCACCAGCGTGAGGTCCACTTCATGAAGCGGCTGCCCCGGGGCCACCACACCACCGAGC
  AGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCC
  AGAGGACTTGGGCCCCCGAGCCCCGATAGGTGCTGCCTGGCCCTCCCCACAATGCCAGAC
  CGCAGAGAGGCTCATCCTGTAGGGCACCCAAAACTCAAGCAAGATGAGCTGTGCGCTGCT
  CTGCAGGCTGGGGAGGTGCTGGGAGAGCCCTGGGTTCCGGTTGTTGATATTGTTTGCTGT
  TGGGTTTTTGCTGCTTTTTTTTTTTTTTTTTT
  
• Restriction Sites: Please inquire
• ACCN: NM_033163
• Insert Size: 930 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033163.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033163.1, NP_149353.1
• RefSeq Size: 1107 bp
• RefSeq ORF: 735 bp
• Locus ID: 2253
• Cytogenetics: 10q24.32
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (F) encodes the longest isoform (F). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.