B3GALNT1 (NM_033168) Human Untagged Clone

CAT#: SC305583

B3GALNT1 (untagged)-Human beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) (B3GALNT1), transcript variant 3


  "NM_033168" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "B3GALNT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B3GALNT1
Synonyms B3GALT3; beta3Gal-T3; galT3; Gb4Cer; GLCT3; GLOB; P; P1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_033168, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCGGCTCTCTGGACTGTCCTTCCGAGTAGGATGTCACTGAGATCCCTCAAATGG
AGCCTCCTGCTGCTGTCACTCCTGAGTTTCTTTGTGATGTGGTACCTCAGCCTTCCCCAC
TACAATGTGATAGAACGCGTGAACTGGATGTACTTCTATGAGTATGAGCCGATTTACAGA
CAAGACTTTCACTTCACACTTCGAGAGCATTCAAACTGCTCTCATCAAAATCCATTTCTG
GTCATTCTGGTGACCTCCCACCCTTCAGATGTGAAAGCCAGGCAGGCCATTAGAGTTACT
TGGGGTGAAAAAAAGTCTTGGTGGGGATATGAGGTTCTTACATTTTTCTTATTAGGCCAA
GAGGCTGAAAAGGAAGACAAAATGTTGGCATTGTCCTTAGAGGATGAACACCTTCTTTAT
GGTGACATAATCCGACAAGATTTTTTAGACACATATAATAACCTGACCTTGAAAACCATT
ATGGCATTCAGGTGGGTAACTGAGTTTTGCCCCAATGCCAAGTACGTAATGAAGACAGAC
ACTGATGTTTTCATCAATACTGGCAATTTAGTGAAGTATCTTTTAAACCTAAACCACTCA
GAGAAGTTTTTCACAGGTTATCCTCTAATTGATAATTATTCCTATAGAGGATTTTACCAA
AAAACCCATATTTCTTACCAGGAGTATCCTTTCAAGGTGTTCCCTCCATACTGCAGTGGG
TTGGGTTATATAATGTCCAGAGATTTGGTGCCAAGGATCTATGAAATGATGGGTCACGTA
AAACCCATCAAGTTTGAAGATGTTTATGTCGGGATCTGTTTGAATTTATTAAAAGTGAAC
ATTCATATTCCAGAAGACACAAATCTTTTCTTTCTATATAGAATCCATTTGGATGTCTGT
CAACTGAGACGTGTGATTGCAGCCCATGGCTTTTCTTCCAAGGAGATCATCACTTTTTGG
CAGGTCATGCTAAGGAACACCACATGCCATTATTAA
Restriction Sites Please inquire     
ACCN NM_033168
ORF Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033168.2, NP_149358.1
RefSeq Size 3224
RefSeq ORF 996
Locus ID 8706
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Metabolic pathways
Gene Summary This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (3) encodes isoform b. Variants 1-5 and 8-39 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.