GNG8 (NM_033258) Human Untagged Clone

CAT#: SC305602

GNG8 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 8 (GNG8)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNG8
• Synonyms: guanine nucleotide binding protein (G protein), gamma 8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033258, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAACAACATGGCCAAGATTGCCGAGGCCCGCAAGACGGTGGAACAGCTGAAGCTGGAGGTGAACA
  TCGACCGCATGAAGGTGTCGCAGGCAGCAGCGGAACTCCTGGCTTTCTGCGAGACGCATGCCAAAGATGA
  CCCGCTGGTGACGCCAGTACCCGCCGCGGAGAACCCCTTCCGCGACAAGCGCCTCTTTTGTGTTCTGCTC
  TGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033258
• ORF Size: 213 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_033258.1, NP_150283.1
• RefSeq Size: 213
• RefSeq ORF: 213
• Locus ID: 94235
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway
• Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. [UniProtKB/Swiss-Prot Function]