Tumor protein D52 like 3 (TPD52L3) (NM_033516) Human Untagged Clone

CAT#: SC305653

TPD52L3 (untagged)-Human tumor protein D52-like 3 (TPD52L3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TPD52L3
• Synonyms: D55; hD55; NYDSP25
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_033516 edited
  ACAGGCCAGGTCGTCAACTCAACTGTCAAGGTGTCCATTGTACCAGCTGGGCCATGGATC
  CCTCCCGCCTGAAATCTGACTCCACCTGCCAAGAGTCTGAGCCTGCAGGCCTAGATTTCG
  ACTCTGCTGGCCAAGATTATTTCTCTGCAGCCCAATAATTCGACTCTTTCTACCAAGAAT
  TGGACCTGGACTCTCTTAACGAAGATCTTCTTTCCCAGTCCATGCCACATGCCAGGACAG
  AGACCTCTGTGGGCACATATGAATCCCACTCGACTTCTGAACTGGAGGATCTGACAGAGC
  CCGAGCAAAGAGAGCTCAAAACCAAACTCACTAAATTGGAGGCTGAAATTGTAACCCTAC
  GCCACGTACTAGCAGCCAAAGAGAGACGCTGTGGGGAACTCAAGAGGAAGTTAGGCCTCA
  CCGCCTTGGTAGGGCTGAGACAGAATCTGTCCAAGAGCTGGCTTGATGTTCAGGTCTCCA
  ACACCTATGTGAAACAGAAGACATCAGCTGCTCTGTCCACCATGGGCACTCTCATCTGCA
  GGAAGCTTGGAGGCGTGAAGAAGTCGGCCACACTCAGATCTTTTGAAGGTCTGATGGGGA
  CAATCAAGTCCAAAGTCTCA:GGGGCAAAAGAGCTTGGCCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_033516
• ORF Size: 423 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033516.4.

Reference Data

• RefSeq: NM_033516.4, NP_277051.3
• RefSeq Size: 2298
• RefSeq ORF: 423
• Locus ID: 89882
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the tumor protein D52-like family of proteins. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. The encoded protein may play a role in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.