FGF13 (NM_033642) Human Untagged Clone

CAT#: SC305664

FGF13 (untagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF13
• Synonyms: FGF-13; FGF2; FHF-2; FHF2; LINC00889
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033642, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTTGTTAAGGAAGTCGTATTCAGAGCCTCAGCTTAAGGGTATAGTTACCAAGCTATACAGCCGAC
  AAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGATGGCACCAAAGATGAGGACAGCACTTACAC
  TCTGTTTAACCTCATCCCTGTGGGTCTGCGAGTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTG
  GCAATGAACAGTGAGGGATACTTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAG
  TGTTTGAAAATTATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTA
  TCTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCTGCAGCTCAT
  TTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCACGATCTCACGGAGTTCTCCC
  GATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCTGGCGTGCTGAACGGAGGCAAATCCATGAG
  CCACAATGAATCAACGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033642
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033642.2, NP_378668.1
• RefSeq Size: 1968 bp
• RefSeq ORF: 579 bp
• Locus ID: 2258
• Cytogenetics: Xq26.3-q27.1
• Protein Families: Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located in a region on chromosome X, which is associated with Borjeson-Forssman-Lehmann syndrome (BFLS), making it a possible candidate gene for familial cases of the BFLS, and for other syndromal and nonspecific forms of X-linked cognitive disability mapping to this region. Alternative splicing of this gene at the 5' end results in several transcript variants encoding different isoforms with different N-termini. [provided by RefSeq, Nov 2008]'
  Transcript Variant: This variant (6) contains an alternate 5' terminal exon compared to transcript variant 1. This results in the shortest isoform (5) with a different N-terminus compared to isoform 1.