CLRN1 (NM_052995) Human Untagged Clone

CAT#: SC305711

CLRN1 (untagged)-Human clarin 1 (CLRN1), transcript variant 4


  "NM_052995" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLRN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLRN1
Synonyms RP61; USH3; USH3A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_052995, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCCCTGCAGCAGCAACCAGTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGC
ATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACA
GCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGG
CTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCC
TCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTAT
GTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCTGGCTGACTAAAGGCCACAGC
TGA
Restriction Sites Please inquire     
ACCN NM_052995
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_052995.2, NP_443721.1
RefSeq Size 1444 bp
RefSeq ORF 363 bp
Locus ID 7401
Cytogenetics 3q25.1
Protein Families Transmembrane
Gene Summary 'This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) contains multiple differences in the UTRs and coding region compared to variant 5. The resulting isoform (c) contains shorter and distinct N- and C-termini, compared to isoform d. Sequence Note: This variant (4) is not currently confirmed by EST evidence. The start codon is located within a different exon, compared to variant 1. Two publications (PMID:12145752 and PMID:11524702) support the existence of variant 4. PMID:12145752 suggests that this variant (4) is a minor variant compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.