GNG2 (NM_053064) Human Untagged Clone

CAT#: SC305721

GNG2 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 2 (GNG2)


  "NM_053064" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GNG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNG2
Synonyms G protein; guanine nucleotide-binding protein G(I)/G(O) gamma-2 subunit; guanine nucleotide binding protein (G protein), gamma 2; guanine nucleotide binding protein gamma 2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_053064 edited
ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAG
ATGGAAGCCAATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTAC
TGTGAAGCACATGCCAAGGAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCG
TTTAGGGAGAAGAAGTTTTTCTGTGCCATCCTTTAA
>OriGene 5' read for NM_053064 unedited
TTAGGAACTGAAGAGTGTTTCTGAAAGATCTATCCAGCACTCCGATGGCCAGCAACAACA
CCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCAATATCG
ACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCA
AGGAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGT
TTTTCTGTGCCATCCTTTAAGTCTTTGAGAGGGGCCTGAAGAGCCTCCGGGCTCCTGGGA
CATTGATGTAGAGTTTTTAGTGAAGTGGGCACCTTTCTAGTCCACGGCATTTGAAGAGAG
CGAGGAGAACCATTCTGGAAACTCTAGGCTATGCATGTTTAAAGATCTGGTCCCCTTTAT
GAGAATGCAAGCCGATCCACATCCTGACTTAAGAGATCTGATTCTGACGAACTGCCTGGA
GGAGGGGAATATATAAAAATAAAATTGGTGTCACTTCTTTTCTGCTATCCCCCAGCCCCC
CCCCCAAAATCCTCATGTTTCTGCTTCATATTTTGAAAAATAACAATTAAAACAGACAGC
TGTACTGAGGTAAGATATGTGTGACCTTCTTGGATGAATATTGTCTTTAGAATACCCTTT
GATAGCTGAGCTGTCCCGTGTAATGCANTNCNNGTTAATGCATTGAGTATAGNCACTGTG
CTTTCTTTTTTTNTTNCTTTNNCTTACCCTNCTTTCACCCCTCCATANAGTATGTGAGAT
AAGCTGGACTGTCTATCAGATGACTCCAGAA
Restriction Sites NotI-NotI     
ACCN NM_053064
ORF Size 216 bp
Insert Size 3000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Reference Data
RefSeq NM_053064.2, NP_444292.1
RefSeq Size 3460
RefSeq ORF 216
Locus ID 54331
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.