CRYBA2 (NM_057094) Human Untagged Clone

CAT#: SC305738

CRYBA2 (untagged)-Human crystallin, beta A2 (CRYBA2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRYBA2
• Synonyms: CTRCT42
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_057094, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCAGCGCCCCCGCGCCGGGCCCGGCGCCCGCCAGCCTCACGCTCTGGGACGAGGAGGACTTCCAGG
  GCCGTCGCTGTCGGCTGCTAAGCGACTGTGCGAACGTCTGCGAGCGCGGAGGCCTGCCCAGGGTGCGCTC
  GGTCAAGGTGGAAAACGGCGTTTGGGTGGCCTTTGAGTACCCCGACTTCCAGGGACAGCAGTTCATTCTG
  GAGAAGGGAGACTATCCTCGCTGGAGCGCCTGGAGTGGCAGCAGCAGCCACAACAGCAACCAGCTGCTGT
  CCTTCCGGCCAGTGCTCTGCGCGAACCACAATGACAGCCGTGTGACACTGTTTGAGGGGGACAACTTCCA
  AGGCTGCAAGTTTGACCTCGTTGATGACTACCCATCCCTGCCCTCCATGGGCTGGGCCAGCAAGGATGTG
  GGTTCCCTCAAAGTCAGCTCCGGAGCGTGGGTGGCCTACCAGTACCCAGGCTACCGAGGCTACCAGTATG
  TGTTGGAGCGGGACCGGCACAGCGGAGAGTTCTGTACTTACGGTGAGCTCGGCACACAGGCCCACACTGG
  GCAGCTGCAGTCCATCCGGAGAGTCCAGCACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_057094
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_057094.1, NP_476435.1
• RefSeq Size: 709 bp
• RefSeq ORF: 594 bp
• Locus ID: 1412
• Cytogenetics: 2q35
• Gene Summary: 'Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) contains a different 5' UTR region when compared to variant 1, and lacks an internal 5' UTR region when compared to variant 2. It encodes a protein identical to that encoded by variants 2 and 3.