CYP26A1 (NM_057157) Human Untagged Clone

CAT#: SC305741

CYP26A1 (untagged)-Human cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CYP26A1
• Synonyms: CP26; CYP26; P450RAI; P450RAI1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_057157, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCGCAGGAAATACGGCTTCATCTACAAGACGCATCTGTTCGGGCGGCCCACCGTACGGGTGATGG
  GCGCGGACAATGTGCGGCGCATCTTGCTCGGAGAGCACCGGCTGGTGTCGGTCCACTGGCCAGCGTCGGT
  GCGCACCATTCTGGGATCTGGCTGCCTCTCTAACCTGCACGACTCCTCGCACAAGCAGCGCAAGAAGGTG
  ATTATGCGGGCCTTCAGCCGCGAGGCACTCGAATGCTACGTGCCGGTGATCACCGAGGAAGTGGGCAGCA
  GCCTGGAGCAGTGGCTGAGCTGCGGCGAGCGCGGCCTCCTGGTCTACCCCGAGGTGAAGCGCCTCATGTT
  CCGAATCGCCATGCGCATCCTACTGGGCTGCGAACCCCAACTGGCGGGCGACGGGGACTCCGAGCAGCAG
  CTTGTGGAGGCCTTCGAGGAAATGACCCGCAATCTCTTCTCGCTGCCCATCGACGTGCCCTTCAGCGGGC
  TGTACCGGGGCATGAAGGCGCGGAACCTCATTCACGCGCGCATCGAGCAGAACATTCGCGCCAAGATCTG
  CGGGCTGCGGGCATCCGAGGCGGGCCAGGGCTGCAAAGACGCGCTGCAGCTGTTGATCGAGCACTCGTGG
  GAGAGGGGAGAGCGGCTGGACATGCAGGCACTAAAGCAATCTTCAACCGAACTCCTCTTTGGAGGACACG
  AAACCACGGCCAGTGCAGCCACATCTCTGATCACTTACCTGGGGCTCTACCCACATGTTCTCCAGAAAGT
  GCGAGAAGAGCTGAAGAGTAAGGGTTTACTTTGCAAGAGCAATCAAGACAACAAGTTGGACATGGAAATT
  TTGGAACAACTTAAATACATCGGGTGTGTTATTAAGGAGACCCTTCGACTGAATCCCCCAGTTCCAGGAG
  GGTTTCGGGTTGCTCTGAAGACTTTTGAATTAAATGGATACCAGATTCCCAAGGGCTGGAATGTTATCTA
  CAGTATCTGTGATACTCATGATGTGGCAGAGATCTTCACCAACAAGGAAGAATTTAATCCTGACCGATTC
  ATGCTGCCTCACCCAGAGGATGCATCCAGGTTCAGCTTCATTCCATTTGGAGGAGGCCTTAGGAGCTGTG
  TAGGCAAAGAATTTGCAAAAATTCTTCTCAAAATATTTACAGTGGAGCTGGCCAGGCATTGTGACTGGCA
  GCTTCTAAATGGACCTCCTACAATGAAAACCAGTCCCACCGTGTATCCTGTGGACAATCTCCCTGCAAGA
  TTCACCCATTTCCATGGGGAAATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_057157
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_057157.2, NP_476498.1
• RefSeq Size: 2245 bp
• RefSeq ORF: 1287 bp
• Locus ID: 1592
• Cytogenetics: 10q23.33
• Protein Families: Druggable Genome, P450, Transmembrane
• Protein Pathways: Retinol metabolism
• Gene Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) contains an alternate 5' end region, which doesn't contain an in-frame translation start codon, when compared to variant 1. Translation thus begins at a downstream start codon, and results in a N-terminal truncated protein, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.