SPAG11B (NM_058203) Human Untagged Clone
CAT#: SC305771
SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant C
"NM_058203" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPAG11B |
Synonyms | EDDM2B; EP2; EP2C; EP2D; HE2; HE2C; SPAG11; SPAG11A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_058203, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAACGATTGCTCCCGTCCGTCACCAGCCTTCTCCTTGTGGCCCTGCTGTTTCCA GGATCGTCTCAAGCCAGACATGTGAACCACTCAGCCACTGAGGCTCTCGGAGAACTCAGG GAAAGAGCCCCTGGGCAAGGCACAAACGGGTTTCAGCTGCTACGCCACGCAGTGAAACGG GACCTCTTACCACCGCGCACCCCACCTTACCAAGAACCTGCATCAGATTTAAAAGTTGTT GACTGCAGGAGAAGTGAAGGCTTCTGCCAAGAATACTGTAATTATATGGAAACACAAGTA GGCTACTGCTCTAAAAAGAAAGACGCCTGCTGTTTACATTAA |
Restriction Sites | Please inquire |
ACCN | NM_058203 |
ORF Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_058203.1, NP_478110.1 |
RefSeq Size | 530 |
RefSeq ORF | 342 |
Locus ID | 10407 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (C) has an alternate 3' UTR, compared to variant A. The resulting isoform (C) has an unique C-terminus and a region with similarity to beta-defensins. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221184 | SPAG11B (Myc-DDK-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant C |
USD 420.00 |
|
RG221184 | SPAG11B (GFP-tagged) - Human sperm associated antigen 11B (SPAG11B), transcript variant C |
USD 460.00 |
|
RC221184L3 | Lenti-ORF clone of SPAG11B (Myc-DDK-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant C |
USD 620.00 |
|
RC221184L4 | Lenti-ORF clone of SPAG11B (mGFP-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant C |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review