p18 INK4c (CDKN2C) (NM_078626) Human Untagged Clone

CAT#: SC305779

CDKN2C (untagged)-Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDKN2C
• Synonyms: INK4C; p18; p18-INK4C
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_078626, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTAGAGCAACTTACTAGTT
  TGTTGCAAAATAATGTAAACGTCAATGCACAAAATGGATTTGGAAGGACTGCGCTGCAGGTTATGAAACT
  TGGAAATCCCGAGATTGCCAGGAGACTGCTACTTAGAGGTGCTAATCCCGATTTGAAAGACCGAACTGGT
  TTCGCTGTCATTCATGATGCGGCCAGAGCAGGTTTCCTGGACACTTTACAGACTTTGCTGGAGTTTCAAG
  CTGATGTTAACATCGAGGATAATGAAGGGAACCTGCCCTTGCACTTGGCTGCCAAAGAAGGCCACCTCCG
  GGTGGTGGAGTTCCTGGTGAAGCACACGGCCAGCAATGTGGGGCATCGGAACCATAAGGGGGACACCGCC
  TGTGATTTGGCCAGGCTCTATGGGAGGAATGAGGTTGTTAGCCTGATGCAGGCAAACGGGGCTGGGGGAG
  CCACAAATCTTCAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_078626
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_078626.2, NP_523240.1
• RefSeq Size: 1273 bp
• RefSeq ORF: 507 bp
• Locus ID: 1031
• Cytogenetics: 1p32.3
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle
• Gene Summary: 'The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to interact with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. Ectopic expression of this gene was shown to suppress the growth of human cells in a manner that appears to correlate with the presence of a wild-type RB1 function. Studies in the knockout mice suggested the roles of this gene in regulating spermatogenesis, as well as in suppressing tumorigenesis. Two alternatively spliced transcript variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) contains a different 5' UTR region, and encodes an identical protein, when compared to variant 1.