Histone H2A Bbd (H2AFB3) (NM_080720) Human Untagged Clone

CAT#: SC305820

H2AFB3 (untagged)-Human H2A histone family, member B3 (H2AFB3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: H2AFB3
• Synonyms: H2ABBD; H2AFB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_080720, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGAGGAGGAGGAGACGCCGAGGGTCCTCCGGTGCTGGCGGCCGGGGGCGGACCTGCTCTCGCACCG
  TCCGAGCGGAGCTTTCGTTTTCAGTGAGCCAGGTGGAGCGCAGTCTACGGGAGGGCCACTACGCTCAGCG
  CCTGAGTCGCACGGCGCCGGTCTACCTCGCTGCGGTTATTGAGTACCTGACGGCCAAGGTCCTGGAGCTG
  GCGGGCAACGAGGCCCAGAACAGCGGAGAGCGGAACATCACTCCCCTGCTGCTGGACATGGTGGTTCACA
  ACGACAGGCTACTGAGCACCCTTTTCAACACGACCACCATCTCTCAAGTGGCCCCTGGCGAGGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_080720
• ORF Size: 348 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_080720.1, NP_542451.1
• RefSeq Size: 539
• RefSeq ORF: 348
• Locus ID: 83740
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most telomeric copy. [provided by RefSeq, Oct 2015]