DPH3P1 (NM_080750) Human Untagged Clone

CAT#: SC305829

DPH3P1 (untagged)-Human DPH3, KTI11 homolog (S. cerevisiae) pseudogene 1 (DPH3P1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DPH3P1
• Synonyms: C20orf143; DPH3B; ZCSL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_080750, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGTATTTCATGACGAGGTGGAAATCGAGGACTTCCAATATGACGAGGACTCGGAG
  ACATATTTCTGTCCCTGCCCATGCGGAGATAACTTCTCCATCACCAAGGAAGAGCTGGAG
  AATGGGGAAGGTGTGGCAATGTGTCCAGGCTGCTCTCTCATTATAAAAGTGATTTATGAC
  AAAGATCAGTTTGCGTGTGGAGAAACAGTGCCAGTGCCTTCAGTCAACAAAGAATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_080750
• ORF Size: 237 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_080750.2, NP_542788.1
• RefSeq Size: 667
• RefSeq ORF: 237
• Locus ID: 100132911
• Gene Summary: This gene may represent a processed pseudogene of DPH3, GeneID: 285381, because it lacks the exon/intron structure found in the functional gene. However, it does contain an intact open reading frame and it has not been established that the predicted protein is not translated. The NCBI RefSeq Project continues to treat this as a protein coding gene in agreement with Swiss-Prot. [provided by RefSeq, Jan 2014]