GPHA2 (NM_130769) Human Untagged Clone

CAT#: SC305899

GPHA2 (untagged)-Human glycoprotein hormone alpha 2 (GPHA2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPHA2
• Synonyms: A2; GPA2; ZSIG51
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130769, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTATGGCGTCCCCTCAAACCCTGGTCCTCTATCTGCTGGTCCTGGCAGTCACTGAAGCCTGGGGCC
  AGGAGGCAGTCATCCCAGGCTGCCACTTGCACCCCTTCAATGTGACAGTGCGAAGTGACCGCCAAGGCAC
  CTGCCAGGGCTCCCACGTGGCACAGGCCTGTGTGGGCCACTGTGAGTCCAGCGCCTTCCCTTCTCGGTAC
  TCTGTGCTGGTGGCCAGTGGTTACCGACACAACATCACCTCCGTCTCTCAGTGCTGCACCATCAGTGGCC
  TGAAGAAGGTCAAAGTACAGCTGCAGTGTGTGGGGAGCCGGAGGGAGGAGCTCGAGATCTTCACGGCCAG
  GGCCTGCCAGTGTGACATGTGTCGCCTCTCTCGCTACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130769
• ORF Size: 390 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130769.3, NP_570125.1
• RefSeq Size: 774
• RefSeq ORF: 390
• Locus ID: 170589
• Protein Families: Secreted Protein
• Gene Summary: GPHA2 is a cystine knot-forming polypeptide and a subunit of the dimeric glycoprotein hormone family (Hsu et al., 2002 [PubMed 12089349]). [supplied by OMIM, Mar 2008]