CST11 (NM_130794) Human Untagged Clone

CAT#: SC305907

CST11 (untagged)-Human cystatin 11 (CST11), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CST11
• Synonyms: CST8L; CTES2; dJ322G13.6; SC13
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130794, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGGCTGAGCCCTGGCAGGCCCTACAGCTCCTGTTGGCCATTCTATTGACTCTGATGGCCCTCCCCT
  ACCAAGCAAGGAAGAAAACCTTTCTAAGCGTCCATGAAGTGATGGCAGTAGAAAACTATGCGAAGGACAG
  CTTGCAGTGGATCACCGACCAGTATAACAAGGAAAGTGATGACAAGTACCACTTCAGGATCTTCCGAGTC
  CTTAAAGTCCAGAGGCAGGTCACTGACCACCTGGAGTATCACCTGAATGTGGAAATGCAGTGGACCACCT
  GCCAAAAGCCAGAGACCACGAACTGTGTCCCCCAGGAAAGGGAGCTTCACAAGCAAGTCAACTGCTTCTT
  CTCAGTGTTTGCTGTACCCTGGTTTGAACAGTACAAAATTTTGAACAAAAGCTGCAGCAGTGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130794
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130794.1, NP_570612.1
• RefSeq Size: 553
• RefSeq ORF: 417
• Locus ID: 140880
• Protein Families: Transmembrane
• Gene Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein shown to have antimicrobial activity against E. coli. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (1) is the longest transcript, encoding the full-length isoform (1).