WWOX (NM_130844) Human Untagged Clone

CAT#: SC305918

WWOX (untagged)-Human WW domain containing oxidoreductase (WWOX), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WWOX
• Synonyms: D16S432E; FOR; FRA16D; HHCMA56; PRO0128; SCAR12; SDR41C1; WOX1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130844, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGCGCTGCGCTACGCGGGGCTGGACGACACGGACAGTGAGGACGAGCTGCCTCCGGGCTGGGAGG
  AGAGAACCACCAAGGACGGCTGGGTTTACTACGCCAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130844
• ORF Size: 111 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130844.2, NP_570859.1
• RefSeq Size: 793
• RefSeq ORF: 111
• Locus ID: 51741
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (3) has a much shorter and alternate 3' end, as compared to variant 1. It encodes the shortest isoform (3) which contains only part of the first WW domain and lacks the second WW domain and the SRD region.