DYNLRB2 (NM_130897) Human Untagged Clone

CAT#: SC305925

DYNLRB2 (untagged)-Human dynein, light chain, roadblock-type 2 (DYNLRB2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DYNLRB2
• Synonyms: DNCL2B; DNLC2B; ROBLD2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130897, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAGGTGGAGGAAACCTTAAAGAGGATCCAGAGTCATAAAGGGGTTATTGGAACTATGGTTGTAA
  ATGCAGAAGGTATTCCCATCCGAACAACCTTGGACAACTCAACAACTGTTCAATATGCAGGCCTTCTTCA
  TCACCTGACAATGAAAGCCAAAAGCACAGTTCGTGATATTGATCCTCAGAACGACCTGACTTTTCTTAGG
  ATCAGATCAAAGAAACATGAAATCATGGTAGCTCCAGATAAGGAATATCTTCTGATCGTCATTCAGAATC
  CATGTGAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130897
• ORF Size: 291 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130897.2, NP_570967.1
• RefSeq Size: 667
• RefSeq ORF: 291
• Locus ID: 83657
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the shorter isoform (1).