CD99L2 (NM_134445) Human Untagged Clone

CAT#: SC305989

CD99L2 (untagged)-Human CD99 molecule-like 2 (CD99L2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD99L2
• Synonyms: CD99B; MIC2L1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_134445, the custom clone sequence may differ by one or more nucleotides
  ATGGTGGCCTGGCGCTCGGCGTTCCTTGTCTGCCTCGCTTTCTCCTTGGCCACCCTGGTC
  CAGCGAGGATCTGGGGACTTTGATGATTTTAACCTGGAGGATGCAGTGAAAGAAACTTCC
  TCAGTAAAGCGAAATGATTTTGACTTGGCTGATGCCCTGGATGATCGAAATGATCGAGAT
  GATGGCCGCAGGAAACCAATTGCTGGAGGAGGAGGTTTTTCAGACAAGGATCTTGAAGAC
  ATAGTAGGGGGTGGAGAATACAAACCTGACAAGGGTAAAGGTGATGGCCGGTACGGCAGC
  AATGACGACCCTGGATCTGGCATGGTGGCAGAGCCTGGCACCATTGCCGGGGTGGCCAGC
  GCCCTGGCCATGGCCCTCATCGGTGCCGTCTCCAGCTACATCTCCTACCAGCAGAAGAAG
  TTCTGCTTCAGCATTCAGCAGGGTCTCAACGCAGACTACGTGAAGGGAGAGAACCTGGAA
  GCCGTGGTATGTGAGGAACCCCAAGTGAAATACTCCACGTTGCACACGCAGTCTGCAGAG
  CCGCCGCCGCCGCCCGAACCAGCCCGGATCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_134445
• ORF Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_134445.2, NP_604394.1
• RefSeq Size: 3419
• RefSeq ORF: 573
• Locus ID: 83692
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a cell-surface protein that is similar to CD99. A similar protein in mouse functions as an adhesion molecule during leukocyte extravasation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (3) lacks three consecutive in-frame exons in one region and an in-frame exon in another region, compared to variant 5. The resulting isoform (3, also referred to as E4) lacks two internal segments, compared to isoform 5.