Bcl G (BCL2L14) (NM_138723) Human Untagged Clone

CAT#: SC306067

BCL2L14 (untagged)-Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 4


  "NM_138723" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BCL2L14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2L14
Synonyms BCLG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138723, the custom clone sequence may differ by one or more nucleotides


ATGTGTAGCACCAGTGGGTGTGACCTGGAAGAAATCCCCCTAGATGATGATGACCTAAACACCATAGAAT
TCAAAATCCTCGCCTACTACACCAGACATCATGTCTTCAAGAGCACCCCTGCTCTCTTCTCACCAAAGCT
GCTGAGAACAAGAAGTTTGTCCCAGAGGGGCCTGGGGAATTGTTCAGCAAATGAGTCATGGACAGAGGTG
TCATGGCCTTGCAGAAATTCCCAATCCAGTGAGAAGGCCATAAACCTTGGCAAGAAAAAGTCTTCTTGGA
AAGCATTCTTTGGAGTAGTGGAGAAGGAAGATTCGCAGAGCACGCCTGCCAAGGTCTCTGCTCAGGGTCA
AAGGACGTTGGAATACCAAGATTCGCACAGCCAGCAGTGGTCCAGGTGTCTTTCTAACGTGGAGCAGTGC
TTGGAGCATGAAGCTGTGGACCCCAAAGTCATTTCCATTGCCAACCGAGTAGCTGAAATTGTTTACTCCT
GGCCACCACCACAAGCGACCCAGGCAGGAGGCTTCAAGTCCAAAGAGATTTTTGTAACTGAGGGTCTCTC
CTTCCAGCTCCAAGGCCACGTGCCTGTAGCTTCAAGTTCTAAGAAAGATGAAGAAGAACAAATACTAGCC
AAAATTGTTGAGCTGCTGAAATATTCAGGAGATCAGTTGGAAAGAAAGCTGAAGAAAGATAAGGCTTTGA
TGGGCCACTTCCAGGATGGGCTGTCCTACTCTGTTTTCAAGACCATCACAGACCAGGTCCTAATGGGTGT
GGACCCCAGGGGAGAATCAGAGGTCAAAGCTCAGGGCTTTAAGGCTGCCCTTGTAATAGACGTCACGGCC
AAGCTCACAGCTATTGACAACCACCCGATGAACAGGGTCCTGGGCTTTGGCACCAAGTACCTGAAAGAGA
ACTTCTCGCCATGGATCCAGCAGCACGGTGGATGGGAAAAAATACTTGGGATATCACATGAAGAAGTAGA
CTGA


Restriction Sites SgfI-MluI     
ACCN NM_138723
ORF Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138723.1, NP_620049.1
RefSeq Size 1930
RefSeq ORF 984
Locus ID 79370
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (4) contains a distinct 5' UTR region, and encodes the identical isoform (1), when compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.