NETO1 (NM_138999) Human Untagged Clone

CAT#: SC306098

NETO1 (untagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NETO1
• Synonyms: BCTL1; BTCL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138999, the custom clone sequence may differ by one or more nucleotides
  ATGCTGGCAGAGCCATTCCCTAAGGTTGTAGCAAGTTTAATCATCCTCCATTTGTCTGGG
  GCAACCAAGAAAGGAACAGAAAAGCAAACCACCTCAGAAACACAGAAGTCAGTGCAGTGT
  GGAACTTGGACAAAACATGCAGAGGGAGGTATCTTTACCTCTCCCAACTATCCCAGCAAG
  TATCCCCCTGACCGGGAATGCATCTACATCATAGAAGCCGCTCCAAGACAGTGCATTGAA
  CTTTACTTTGATGAAAAGTACTCTATTGAACCGTCTTGGGAGTGCAAATTTGATCATATT
  GAAGTTCGAGATGGACCTTTTGGCTTTTCTCCAATAATTGGACGTTTCTGTGGACAACAA
  AATCCACCTGTCATAAAATCCAGTGGAAGATTTCTATGGATTAAATTTTTTGCTGATGGA
  GAGCTGGAATCTATGGGATTTTCAGCTCGATACAATTTCACACCTGAATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_138999
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138999.1, NP_620552.1
• RefSeq Size: 1849
• RefSeq ORF: 471
• Locus ID: 81832
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. This protein is thought to play a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2017]
  Transcript Variant: This variant (1), also known as sNETO1, encodes isoform 1 and was described by Stohr et. al (PMID:11943477).