HFE (NM_139008) Human Untagged Clone

CAT#: SC306103

HFE (untagged)-Human hemochromatosis (HFE), transcript variant 8


  "NM_139008" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HFE
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_139008, the custom clone sequence may differ by one or more nucleotides
ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTG
CAGGGGCGCTTGCTGCAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAA
GACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTC
TGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAG
TGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCT
GCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGTGACCACT
CTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGAT
AAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGG
ACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGC
CAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCT
GGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATT
GGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTAC
GTCTTAGCTGAACGTGAGTGA
Restriction Sites Please inquire     
ACCN NM_139008
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_139008.1, NP_620577.1
RefSeq Size 781 bp
RefSeq ORF 741 bp
Locus ID 3077
Cytogenetics 6p22.2
Protein Families Druggable Genome, Transmembrane
Gene Summary 'The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (8) lacks two internal in-frame segments of the coding region, as compared to variant 1, resulting in a shorter protein (isoform 8).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.