Claudin 14 (CLDN14) (NM_144492) Human Untagged Clone
CAT#: SC306147
CLDN14 (untagged)-Human claudin 14 (CLDN14), transcript variant 1
"NM_144492" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLDN14 |
Synonyms | DFNB29 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_144492, the custom clone sequence may differ by one or more nucleotides
ATGGCCAGCACGGCCGTGCAGCTTCTGGGCTTCCTGCTCAGCTTCCTGGGCATGGTGGGCACGTTGATCA CCACCATCCTGCCGCACTGGCGGAGGACAGCGCACGTGGGCACCAACATCCTCACGGCCGTGTCCTACCT GAAAGGGCTCTGGATGGAGTGTGTGTGGCACAGCACAGGCATCTACCAGTGCCAGATCTACCGATCCCTG CTGGCGCTGCCCCAAGACCTCCAGGCTGCCCGCGCCCTCATGGTCATCTCCTGCCTGCTCTCGGGCATAG CCTGCGCCTGCGCCGTCATCGGGATGAAGTGCACGCGCTGCGCCAAGGGCACACCCGCCAAGACCACCTT TGCCATCCTCGGCGGCACCCTCTTCATCCTGGCCGGCCTCCTGTGCATGGTGGCCGTCTCCTGGACCACC AACGACGTGGTGCAGAACTTCTACAACCCGCTGCTGCCCAGCGGCATGAAGTTTGAGATTGGCCAGGCCC TGTACCTGGGCTTCATCTCCTCGTCCCTCTCGCTCATTGGTGGCACCCTGCTTTGCCTGTCCTGCCAGGA CGAGGCACCCTACAGGCCCTACCAGGCCCCGCCCAGGGCCACCACGACCACTGCAAACACCGCACCTGCC TACCAGCCACCAGCTGCCTACAAAGACAATCGGGCCCCCTCAGTGACCTCGGCCACGCACAGCGGGTACA GGCTGAACGACTACGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_144492 |
ORF Size | 720 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_144492.2, NP_652763.1 |
RefSeq Size | 1958 |
RefSeq ORF | 720 |
Locus ID | 23562 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
Gene Summary | Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. The encoded protein also binds specifically to the WW domain of Yes-associated protein. Defects in this gene are the cause of an autosomal recessive form of nonsyndromic sensorineural deafness. It is also reported that four synonymous variants in this gene are associated with kidney stones and reduced bone mineral density. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (alpha) represents the longest transcript. All five variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219687 | CLDN14 (Myc-DDK-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
USD 420.00 |
|
RG219687 | CLDN14 (GFP-tagged) - Human claudin 14 (CLDN14), transcript variant 1 |
USD 460.00 |
|
RC219687L3 | Lenti-ORF clone of CLDN14 (Myc-DDK-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
USD 768.00 |
|
RC219687L4 | Lenti-ORF clone of CLDN14 (mGFP-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review