COX6B2 (NM_144613) Human Untagged Clone

CAT#: SC306162

COX6B2 (untagged)-Human cytochrome c oxidase subunit VIb polypeptide 2 (testis) (COX6B2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COX6B2
• Synonyms: COXVIB2; CT59
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_144613, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGGATGTGGAAGCCCAGGAGCCCCCCAAGGGGAAATGGTCGACGCCGCCCTTCGACCCGCGCTTCC
  CCAGCCAGAACCAGATCCGTAACTGCTACCAGAACTTCCTGGACTACCACCGCTGCCTCAAGACCAGGAC
  CCGCCGCGGGAAGAGCACGCAGCCCTGCGAGTACTATTTCCGCGTGTACCACTCGCTGTGCCCCATCAGC
  TGGGTGGAGAGCTGGAACGAGCAGATCAAGAACGGGATTTTCGCCGGCAAAATCTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_144613
• ORF Size: 267 bp
• Insert Size: 1800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: DNA sequence of this clone matches with that of NM_144613.3.

Reference Data

• RefSeq: NM_144613.3, NP_653214.2
• RefSeq Size: 1679
• RefSeq ORF: 267
• Locus ID: 125965
• Protein Pathways: Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: Connects the two COX monomers into the physiological dimeric form. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. All four variants encode the same protein.