HTRA2 (NM_145074) Human Untagged Clone

CAT#: SC306217

HTRA2 (untagged)-Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_145074" in other vectors (6)

Reconstitution Protocol

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HTRA2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HTRA2
Synonyms MGCA8; OMI; PARK13; PRSS25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145074, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCGCCGAGGGCGGGGCGGGGTGCAGGCTGGAGCCTTCGGGCATGGCGGGCTTTGGGGGGCATTC
GCTGGGGGAGGAGACCCCGTTTGACCCCTGACCTCCGGGCCCTGCTGACGTCAGGAACTTCTGACCCCCG
GGCCCGAGTGACTTATGGGACCCCCAGTCTCTGGGCCCGGTTGTCTGTTGGGGTCACTGAACCCCGAGCA
TGCCTGACGTCTGGGACCCCGGGTCCCCGGGCACAACTGACTGCGGTGACCCCAGATACCAGGACCCGGG
AGGCCTCAGAGAACTCTGGAACCCGTTCGCGCGCGTGGCTGGCGGTGGCGCTGGGCGCTGGGGGGGCAGT
GCTGTTGTTGTTGTGGGGCGGGGGTCGGGGTCCTCCGGCCGTCCTCGCCGCCGTCCCTAGCCCGCCGCCC
GCTTCTCCCCGGAGTCAGTACAACTTCATCGCAGATGTGGTGGAGAAGACAGCACCTGCCGTGGTCTATA
TCGAGATCCTGGACCGGCACCCTTTCTTGGGCCGCGAGGTCCCTATCTCGAACGGCTCAGGATTCGTGGT
GGCTGCCGATGGGCTCATTGTCACCAACGCCCATGTGGTGGCTGATCGGCGCAGAGTCCGTGTGAGACTG
CTAAGCGGCGACACGTATGAGGCCGTGGTCACAGCTGTGGATCCCGTGGCAGACATCGCAACGCTGAGGA
TTCAGACTAAGTTTGGAAACTCTGGAGGTCCCCTGGTTAACCTGGATGGGGAGGTGATTGGAGTGAACAC
CATGAAGGTCACAGCTGGAATCTCCTTTGCCATCCCTTCTGATCGTCTTCGAGAGTTTCTGCATCGTGGG
GAAAAGAAGAATTCCTCCTCCGGAATCAGTGGGTCCCAGCGGCGCTACATTGGGGTGATGATGCTGACCC
TGAGTCCCAGGGCTGGTCTGCGGCCTGGTGATGTGATTTTGGCCATTGGGGAGCAGATGGTACAAAATGC
TGAAGATGTTTATGAAGCTGTTCGAACCCAATCCCAGTTGGCAGTGCAGATCCGGCGGGGACGAGAAACA
CTGACCTTATATGTGACCCCTGAGGTCACAGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_145074
ORF Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145074.2, NP_659540.1
RefSeq Size 2259
RefSeq ORF 1086
Locus ID 27429
Domains PDZ
Protein Families Druggable Genome, Protease, Transmembrane
Protein Pathways Parkinson's disease
Gene Summary This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1 and has a modified PDZ domain. Isoform 2 has no detectable protease activity.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.