HTRA2 (NM_145074) Human Untagged Clone
CAT#: SC306217
HTRA2 (untagged)-Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_145074" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HTRA2 |
Synonyms | MGCA8; OMI; PARK13; PRSS25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145074, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCGCCGAGGGCGGGGCGGGGTGCAGGCTGGAGCCTTCGGGCATGGCGGGCTTTGGGGGGCATTC GCTGGGGGAGGAGACCCCGTTTGACCCCTGACCTCCGGGCCCTGCTGACGTCAGGAACTTCTGACCCCCG GGCCCGAGTGACTTATGGGACCCCCAGTCTCTGGGCCCGGTTGTCTGTTGGGGTCACTGAACCCCGAGCA TGCCTGACGTCTGGGACCCCGGGTCCCCGGGCACAACTGACTGCGGTGACCCCAGATACCAGGACCCGGG AGGCCTCAGAGAACTCTGGAACCCGTTCGCGCGCGTGGCTGGCGGTGGCGCTGGGCGCTGGGGGGGCAGT GCTGTTGTTGTTGTGGGGCGGGGGTCGGGGTCCTCCGGCCGTCCTCGCCGCCGTCCCTAGCCCGCCGCCC GCTTCTCCCCGGAGTCAGTACAACTTCATCGCAGATGTGGTGGAGAAGACAGCACCTGCCGTGGTCTATA TCGAGATCCTGGACCGGCACCCTTTCTTGGGCCGCGAGGTCCCTATCTCGAACGGCTCAGGATTCGTGGT GGCTGCCGATGGGCTCATTGTCACCAACGCCCATGTGGTGGCTGATCGGCGCAGAGTCCGTGTGAGACTG CTAAGCGGCGACACGTATGAGGCCGTGGTCACAGCTGTGGATCCCGTGGCAGACATCGCAACGCTGAGGA TTCAGACTAAGTTTGGAAACTCTGGAGGTCCCCTGGTTAACCTGGATGGGGAGGTGATTGGAGTGAACAC CATGAAGGTCACAGCTGGAATCTCCTTTGCCATCCCTTCTGATCGTCTTCGAGAGTTTCTGCATCGTGGG GAAAAGAAGAATTCCTCCTCCGGAATCAGTGGGTCCCAGCGGCGCTACATTGGGGTGATGATGCTGACCC TGAGTCCCAGGGCTGGTCTGCGGCCTGGTGATGTGATTTTGGCCATTGGGGAGCAGATGGTACAAAATGC TGAAGATGTTTATGAAGCTGTTCGAACCCAATCCCAGTTGGCAGTGCAGATCCGGCGGGGACGAGAAACA CTGACCTTATATGTGACCCCTGAGGTCACAGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145074 |
ORF Size | 1086 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_145074.2, NP_659540.1 |
RefSeq Size | 2259 |
RefSeq ORF | 1086 |
Locus ID | 27429 |
Domains | PDZ |
Protein Families | Druggable Genome, Protease, Transmembrane |
Protein Pathways | Parkinson's disease |
Gene Summary | This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1 and has a modified PDZ domain. Isoform 2 has no detectable protease activity. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222206 | HTRA2 (Myc-DDK-tagged)-Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
RG222206 | HTRA2 (GFP-tagged) - Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
RC222206L1 | Lenti ORF clone of Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC222206L2 | Lenti ORF clone of Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC222206L3 | Lenti ORF clone of Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC222206L4 | Lenti ORF clone of Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review