Synaptogyrin 1 (SYNGR1) (NM_145738) Human Untagged Clone

CAT#: SC306268

SYNGR1 (untagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1c

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SYNGR1
• Synonyms: MGC1939
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145738, the custom clone sequence may differ by one or more nucleotides
  ATGTTGACCTTAGAGTTTGGGATTCTGGAATTCGATCCTTCATGGATAGGCAGCTGGACA
  CAGAGGTCGTGGGTGAGCTGGAGGAGCAGGCCCGGATGTGAGCTGTTCTCCATAGTGGTG
  TTCGGCTCCATCGTGAACGAGGGCTACCTCAACAGCGCCTCCGAGGGGGAGGAGTTCTGC
  ATCTACAACCGCAACCCCAACGCCTGCAGCTATGGCGTGGCCGTGGGCGTGCTCGCCTTC
  CTCACCTGCCTGCTGTACCTGGCCCTGGACGTGTACTTCCCGCAGATCAGCAGCGTCAAG
  GACCGCAAGAAAGCCGTCCTGTCCGACATCGGTGTCTCGGCCTTCTGGGCTTTCCTCTGG
  TTCGTGGGATTCTGCTACCTGGCCAACCAGTGGCAGGTCTCCAAGCCCAAGGACAACCCA
  CTGAACGAAGGGACGGACGCAGCCCGGGCCGCCATCGCCTTCTCCTTTTTCTCCATCTTC
  ACCTGGAGCCTGACCGCAGCCCTGGCCGTGCGGAGATTCAAGGACCTAAGCTTCCAGGAG
  GAGTACAGCACACTGTTCCCTGCCTCGGCACAGCCGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_145738
• ORF Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_145738.1, NP_663791.1
• RefSeq Size: 825
• RefSeq ORF: 579
• Locus ID: 9145
• Protein Families: Transmembrane
• Gene Summary: This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1c) encodes the shortest isoform. It contains a distinct 5' UTR and 5' coding region resulting in a frameshift and downstream translation initiation site, when compared to isoform 1a.