CACNG5 (NM_145811) Human Untagged Clone

CAT#: SC306278

CACNG5 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 5 (CACNG5)


  "NM_145811" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNG5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CACNG5
Synonyms MGC126656; MGC126682
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145811, the custom clone sequence may differ by one or more nucleotides


ATGAGTGCCTGCGGGAGGAAGGCCCTGACCCTGCTGAGCAGTGTCTTTGCTGTCTGTGGCTTGGGCCTCC
TGGGTATCGCGGTCAGCACCGACTACTGGCTGTACCTGGAGGAGGGTGTGATTGTGCCCCAGAACCAGAG
CACCGAGATCAAGATGTCCCTGCACTCAGGCCTCTGGCGGGTCTGCTTCCTTGCAGGTGAGGAGCGGGGG
CGTTGCTTCACCATAGAATATGTGATGCCCATGAACACCCAGCTGACATCCGAGTCCACGGTCAATGTTC
TAAAGATGATCCGCTCAGCCACACCATTCCCTCTGGTCAGCCTCTTCTTCATGTTCATTGGGTTTATCCT
GAACAACATCGGACACATCCGTCCCCACCGGACGATACTGGCCTTTGTCTCTGGCATCTTCTTTATCCTC
TCAGGCCTCTCTCTCGTGGTGGGCCTGGTGCTCTACATCTCCAGCATCAACGATGAGATGCTCAACAGGA
CCAAGGATGCAGAGACCTACTTCAACTACAAGTATGGGTGGTCGTTTGCCTTCGCCGCCATCTCCTTCCT
TTTAACGGAGAGTGCCGGGGTGATGTCTGTGTACCTGTTTATGAAGCGGTACACCGCGGAGGACATGTAC
AGGCCCCACCCTGGCTTCTACCGCCCTCGGCTGAGCAACTGCTCCGATTACTCAGGCCAGTTCCTACACC
CAGACGCCTGGGTCAGGGGCCGCAGCCCCTCCGACATCTCCAGCGAGGCCTCCCTGCAGATGAACAGCAA
CTACCCCGCCTTGCTCAAGTGCCCCGACTATGATCAGATGTCCTCTTCACCCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_145811
ORF Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145811.2, NP_665810.1
RefSeq Size 926
RefSeq ORF 828
Locus ID 27091
Protein Families Druggable Genome, Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
Gene Summary The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. This gene is a susceptibility locus for schizophrenia and bipolar disorder. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) encodes the predominant isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.