Kallikrein 10 (KLK10) (NM_145888) Human Untagged Clone

CAT#: SC306286

KLK10 (untagged)-Human kallikrein-related peptidase 10 (KLK10), transcript variant 2


  "NM_145888" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLK10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK10
Synonyms NES1; PRSSL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145888, the custom clone sequence may differ by one or more nucleotides


ATGAGAGCTCCGCACCTCCACCTCTCCGCCGCCTCTGGCGCCCGGGCTCTGGCGAAGCTGCTGCCGCTGC
TGATGGCGCAACTCTGGGCCGCAGAGGCGGCGCTGCTCCCCCAAAACGACACGCGCTTGGACCCCGAAGC
CTATGGCTCCCCGTGCGCGCGCGGCTCGCAGCCCTGGCAGGTCTCGCTCTTCAACGGCCTCTCGTTCCAC
TGCGCGGGTGTCCTGGTGGACCAGAGTTGGGTGCTGACGGCCGCGCACTGCGGAAACAAGCCACTGTGGG
CTCGAGTAGGGGATGACCACCTGCTGCTTCTTCAGGGAGAGCAGCTCCGCCGGACCACTCGCTCTGTTGT
CCATCCCAAGTACCACCAGGGCTCAGGCCCCATCCTGCCAAGGCGAACGGATGAGCACGATCTCATGTTG
CTGAAGCTGGCCAGGCCCGTAGTGCTGGGGCCCCGCGTCCGGGCCCTGCAGCTTCCCTACCGCTGTGCTC
AGCCCGGAGACCAGTGCCAGGTTGCTGGCTGGGGCACCACGGCCGCCCGGAGAGTGAAGTACAACAAGGG
CCTGACCTGCTCCAGCATCACTATCCTGAGCCCTAAAGAGTGTGAGGTCTTCTACCCTGGCGTGGTCACC
AACAACATGATATGTGCTGGACTGGACCGGGGCCAGGACCCTTGCCAGAGTGACTCTGGAGGCCCCCTGG
TCTGTGACGAGACCCTCCAAGGCATCCTCTCGTGGGGTGTTTACCCCTGTGGCTCTGCCCAGCATCCAGC
TGTCTACACCCAGATCTGCAAATACATGTCCTGGATCAATAAAGTCATACGCTCCAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_145888
ORF Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145888.2, NP_665895.1
RefSeq Size 2985
RefSeq ORF 831
Locus ID 5655
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All transcript variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.