Kallikrein 10 (KLK10) (NM_145888) Human Untagged Clone
CAT#: SC306286
KLK10 (untagged)-Human kallikrein-related peptidase 10 (KLK10), transcript variant 2
"NM_145888" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK10 |
Synonyms | NES1; PRSSL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145888, the custom clone sequence may differ by one or more nucleotides
ATGAGAGCTCCGCACCTCCACCTCTCCGCCGCCTCTGGCGCCCGGGCTCTGGCGAAGCTGCTGCCGCTGC TGATGGCGCAACTCTGGGCCGCAGAGGCGGCGCTGCTCCCCCAAAACGACACGCGCTTGGACCCCGAAGC CTATGGCTCCCCGTGCGCGCGCGGCTCGCAGCCCTGGCAGGTCTCGCTCTTCAACGGCCTCTCGTTCCAC TGCGCGGGTGTCCTGGTGGACCAGAGTTGGGTGCTGACGGCCGCGCACTGCGGAAACAAGCCACTGTGGG CTCGAGTAGGGGATGACCACCTGCTGCTTCTTCAGGGAGAGCAGCTCCGCCGGACCACTCGCTCTGTTGT CCATCCCAAGTACCACCAGGGCTCAGGCCCCATCCTGCCAAGGCGAACGGATGAGCACGATCTCATGTTG CTGAAGCTGGCCAGGCCCGTAGTGCTGGGGCCCCGCGTCCGGGCCCTGCAGCTTCCCTACCGCTGTGCTC AGCCCGGAGACCAGTGCCAGGTTGCTGGCTGGGGCACCACGGCCGCCCGGAGAGTGAAGTACAACAAGGG CCTGACCTGCTCCAGCATCACTATCCTGAGCCCTAAAGAGTGTGAGGTCTTCTACCCTGGCGTGGTCACC AACAACATGATATGTGCTGGACTGGACCGGGGCCAGGACCCTTGCCAGAGTGACTCTGGAGGCCCCCTGG TCTGTGACGAGACCCTCCAAGGCATCCTCTCGTGGGGTGTTTACCCCTGTGGCTCTGCCCAGCATCCAGC TGTCTACACCCAGATCTGCAAATACATGTCCTGGATCAATAAAGTCATACGCTCCAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145888 |
ORF Size | 831 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_145888.2, NP_665895.1 |
RefSeq Size | 2985 |
RefSeq ORF | 831 |
Locus ID | 5655 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All transcript variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218377 | KLK10 (Myc-DDK-tagged)-Human kallikrein-related peptidase 10 (KLK10), transcript variant 2 |
USD 420.00 |
|
RG218377 | KLK10 (GFP-tagged) - Human kallikrein-related peptidase 10 (KLK10), transcript variant 2 |
USD 460.00 |
|
RC218377L3 | Lenti ORF clone of Human kallikrein-related peptidase 10 (KLK10), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC218377L4 | Lenti ORF clone of Human kallikrein-related peptidase 10 (KLK10), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review