RBFOX1 (NM_145892) Human Untagged Clone

CAT#: SC306287

RBFOX1 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 2


  "NM_145892" in other vectors (4)

Reconstitution Protocol

USD 670.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RBFOX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBFOX1
Synonyms 2BP1; A2BP1; FOX-1; FOX1; HRNBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145892, the custom clone sequence may differ by one or more nucleotides


ATGCTGGCGTCTCAAGGAGTTCTCCTGCATCCTTATGGCGTGCCTATGATTGTACCGGCAGCTCCTTACC
TTCCTGGACTGATTCAGGGTAATCAGGAAGCAGCCGCTGCCCCTGACACAATGGCTCAGCCTTACGCTTC
GGCCCAGTTTGCTCCCCCGCAGAACGGTATCCCCGCGGAATACACGGCCCCTCATCCCCACCCCGCGCCA
GAGTACACAGGCCAGACCACGGTTCCCGAGCACACATTAAACCTGTACCCTCCCGCCCAGACGCACTCCG
AGCAGAGCCCGGCGGACACGAGCGCTCAGACCGTCTCTGGCACCGCCACACAGACAGATGACGCAGCACC
GACGGATGGCCAGCCCCAGACACAACCTTCTGAAAACACGGAAAACAAGTCTCAGCCCAAGCGGCTGCAT
GTCTCCAATATCCCCTTCAGGTTCCGGGATCCGGACCTCAGACAAATGTTTGGTCAATTTGGTAAAATCT
TAGATGTTGAAATTATTTTTAATGAGCGAGGCTCAAAGGGATTTGGTTTCGTAACTTTCGAAAATAGTGC
CGATGCGGACAGGGCGAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTAAATAAT
GCCACAGCACGTGTAATGACAAATAAAAAGACCGTCAACCCTTATACAAATGGCTGGAAATTGAATCCAG
TTGTGGGTGCAGTCTACAGTCCCGAATTCTATGCAGGCACGGTCCTGTTGTGCCAGGCCAACCAGGAGGG
ATCTTCCATGTACAGTGCCCCCAGTTCACTTGTATATACTTCTGCAATGCCAGGCTTCCCGTATCCAGCA
GCCACCGCCGCGGCCGCCTACCGAGGGGCGCACCTGCGAGGCCGCGGTCGCACCGTGTACAACACCTTCA
GGGCCGCGGCGCCCCCGCCCCCGATCCCGGCCTACGGCGGAGTAGTGTATCAAGAGCCTGTGTATGGCAA
TAAATTGCTGCAGGGTGGTTATGCTGCATACCGCTACGCCCAGCCTACCCCTGCCACTGCCGCTGCCTAC
AGTGACAGTTACGGACGAGTTTATGCTGCCGACCCCTACCACCACGCACTTGCTCCAGCCCCCACCTACG
GCGTTGGTGCCATGGCTAGTATATACCGAGGGGGATACAACCGTTTTGCTCCATACTAA


Restriction Sites SgfI-MluI     
ACCN NM_145892
ORF Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145892.2, NP_665899.1
RefSeq Size 4024
RefSeq ORF 1179
Locus ID 54715
Gene Summary The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2), also known as alpha, lacks an in-frame segment of the 3' coding region, compared to variant 1. This results in a shorter isoform (2) that lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.