CCL28 (NM_148672) Human Untagged Clone

CAT#: SC306320

CCL28 (untagged)-Human chemokine (C-C motif) ligand 28 (CCL28)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCL28
• Synonyms: CCK1; MEC; SCYA28
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_148672, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCAGAGAGGACTCGCCATCGTGGCCTTGGCTGTCTGTGCGGCCCTACATGCCTCAGAAGCCATAC
  TTCCCATTGCCTCCAGCTGTTGCACGGAGGTTTCACATCATATTTCCAGAAGGCTCCTGGAAAGAGTGAA
  TATGTGTCGCATCCAGAGAGCTGATGGGGATTGTGACTTGGCTGCTGTCATCCTTCATGTCAAGCGCAGA
  AGAATCTGTGTCAGCCCGCACAACCATACTGTTAAGCAGTGGATGAAAGTGCAAGCTGCCAAGAAAAATG
  GTAAAGGAAATGTTTGCCACAGGAAGAAACACCATGGCAAGAGGAACAGTAACAGGGCACATCAGGGGAA
  ACACGAAACATACGGCCATAAAACTCCTTATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_148672
• ORF Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_148672.3, NP_683513.1
• RefSeq Size: 3126
• RefSeq ORF: 384
• Locus ID: 56477
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.