TNFRSF18 (NM_148901) Human Untagged Clone

CAT#: SC306328

TNFRSF18 (untagged)-Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 2


  "NM_148901" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TNFRSF18"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNFRSF18
Synonyms AITR; CD357; ENERGEN; GITR; GITR-D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_148901, the custom clone sequence may differ by one or more nucleotides


ATGGCACAGCACGGGGCGATGGGCGCGTTTCGGGCCCTGTGCGGCCTGGCGCTGCTGTGCGCGCTCAGCC
TGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCCCTGGGCGCCTCCTGCTTGGGACGGGAACGGACGC
GCGCTGCTGCCGGGTTCACACGACGCGCTGCTGCCGCGATTACCCGGGCGAGGAGTGCTGTTCCGAGTGG
GACTGCATGTGTGTCCAGCCTGAATTCCACTGCGGAGACCCTTGCTGCACGACCTGCCGGCACCACCCTT
GTCCCCCAGGCCAGGGGGTACAGTCCCAGGGGAAATTCAGTTTTGGCTTCCAGTGTATCGACTGTGCCTC
GGGGACCTTCTCCGGGGGCCACGAAGGCCACTGCAAACCTTGGACAGACTGCTGCTGGAGGTGCCGCCGT
CGACCGAAGACGCCAGAAGCTGCCAGTTCCCCGAGGAAGAGCGGGGCGAGCGATCGGCAGAGGAGAAGGG
GCGGCTGGGAGACCTGTGGGTGTGAGCCTGGCCGTCCTCCGGGGCCACCGACCGCAGCCAGCCCCTCCCC
AGGAGCTCCCCAGGCCGCAGGGGCTCTGCGTTCTGCTCTGGGCCGGGCCCTGCTCCCCTGGCAGCAGAAG
TGGGTGCAGGAAGGTGGCAGTGACCAGCGCCCTGGACCATGCAGTTCGGCGGCCGCGGCTGGGCCCTGCA
GGAGGGAGAGAGAGACACAGTCATGGCCCCCTTCCTCCCTTGCTGGCCCTGATGGGGTGGGGTCTTAG


Restriction Sites SgfI-MluI     
ACCN NM_148901
ORF Size 768 bp
Insert Size 768
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_148901.1, NP_683699.1
RefSeq Size 1003
RefSeq ORF 768
Locus ID 8784
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
Gene Summary This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) encodes the longest protein (isoform 2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.