PSMB9 (NM_148954) Human Untagged Clone

CAT#: SC306334

PSMB9 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) (PSMB9), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMB9
• Synonyms: beta1i; LMP2; MGC70470; PSMB6i; RING12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_148954, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCGGGCGGGAGAAGTCCACACCGGGACCACCATCATGGCAGTGGAGTTTGACGGGGGCGTTGTGA
  TGGGTTCTGATTCCCGAGTGTCTGCAGGCGAGGCGGTGGTGAACCGAGTGTTTGACAAGCTGTCCCCGCT
  GCACGAGCGCATCTACTGTGCACTCTCTGGTTCAGCTGCTGATGCCCAAGCCGTGGCCGACATGGCCGCC
  TACCAGCTGGAGCTCCATGGGATAGAACTGGAGGAACCTCCACTTGTTTTGGCTGCTGCAAATGTGGTGA
  GAAATATCAGCTATAAATATCGAGAGGACTTGTCTGCACATCTCATGGTAGCTGGCTGGGACCAACGTGA
  AGGAGGTCAGGTATATGGAACCCTGGGAGGAATGCTGACTCGACAGCCTTTTGCCATTGGTGGCTCCGGC
  AGCACCTTTATCTATGGTTATGTGGATGCAGCATATAAGCCAGGCATGTCTCCCGAGGAGTGCAGGCGCT
  TCACCACAGACGCTATTGCTCTGGCCATGAGCCGGGATGGCTCAAGCGGGGGTGTCATCTACCTGGTCAC
  TATTACAGCTGCCGGTGTGGACCATCGAGTCATCTTGGGCAATGAACTGCCAAAATTCTATGATGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_148954
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_148954.2, NP_683756.1
• RefSeq Size: 1018 bp
• RefSeq ORF: 630 bp
• Locus ID: 5698
• Cytogenetics: 6p21.32
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Proteasome
• Gene Summary: 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter, distinct N-terminus compared to isoform 1.