OTOS (NM_148961) Human Untagged Clone

CAT#: SC306339

OTOS (untagged)-Human otospiralin (OTOS)


  "NM_148961" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "OTOS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OTOS
Synonyms OTOSP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_148961 edited
GCCCTTGCTGCAGGTGGGCCTGAGTCGCAGATCAGGAAGCACCGGGAAGATGCAGGCCTG
CATGGTGCCGGGGCTGGCCCTCTGCCTCCTACTGGGGCCTCTTGCAGGGGCCAAGCCTGT
GCAGGAGGAAGGAGACCCTTACGCGGAGCTGCCGGCCATGCCCTACTGGCCTTTCTCCAC
CTCTGACTTCTGGAACTATGTGCAGCACTTCCAGGCCCTGGGGGCCTACCCCCAGATCGA
GGACATGGCCCGAACCTTCTTTGCCCACTTCCCCCTGGGGAGCACGCTGGGCTTCCACGT
TCCCTATCAGGAGGACTGAATGGTGTCCAGCCTGGTGCCCGCCCACCCCGCCAGGCTGCA
CTCGGTCGGGCCTCCACAGGCATGGAGTCCCCGCAAAAACCTGGCCCCTGCAGGAG
Restriction Sites Please inquire     
ACCN NM_148961
ORF Size 270 bp
Insert Size 400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_148961.3.
Reference Data
RefSeq NM_148961.3, NP_683764.1
RefSeq Size 566
RefSeq ORF 270
Locus ID 150677
Protein Families Secreted Protein
Gene Summary Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]). [supplied by OMIM, Mar 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.