OTOS (NM_148961) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OTOS |
Synonyms | OTOSP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_148961 edited
GCCCTTGCTGCAGGTGGGCCTGAGTCGCAGATCAGGAAGCACCGGGAAGATGCAGGCCTG CATGGTGCCGGGGCTGGCCCTCTGCCTCCTACTGGGGCCTCTTGCAGGGGCCAAGCCTGT GCAGGAGGAAGGAGACCCTTACGCGGAGCTGCCGGCCATGCCCTACTGGCCTTTCTCCAC CTCTGACTTCTGGAACTATGTGCAGCACTTCCAGGCCCTGGGGGCCTACCCCCAGATCGA GGACATGGCCCGAACCTTCTTTGCCCACTTCCCCCTGGGGAGCACGCTGGGCTTCCACGT TCCCTATCAGGAGGACTGAATGGTGTCCAGCCTGGTGCCCGCCCACCCCGCCAGGCTGCA CTCGGTCGGGCCTCCACAGGCATGGAGTCCCCGCAAAAACCTGGCCCCTGCAGGAG |
Restriction Sites | Please inquire |
ACCN | NM_148961 |
ORF Size | 270 bp |
Insert Size | 400 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_148961.3. |
Reference Data | |
RefSeq | NM_148961.3, NP_683764.1 |
RefSeq Size | 566 |
RefSeq ORF | 270 |
Locus ID | 150677 |
Protein Families | Secreted Protein |
Gene Summary | Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]). [supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211259 | OTOS (Myc-DDK-tagged)-Human otospiralin (OTOS) |
USD 98.00 |
|
RG211259 | OTOS (GFP-tagged) - Human otospiralin (OTOS) |
USD 460.00 |
|
RC211259L3 | Lenti ORF clone of Human otospiralin (OTOS), Myc-DDK-tagged |
USD 620.00 |
|
RC211259L4 | Lenti ORF clone of Human otospiralin (OTOS), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review