nkx6.3 (NKX6-3) (NM_152568) Human Untagged Clone

CAT#: SC306443

NKX6 (untagged)-Human NK6 homeobox 3 (NKX6-3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKX6-3
• Synonyms: NKX6.3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_152568, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCAGGGGCAGCTGGCACCTGGGTCTAGGCTTTGCTCAGGGCCCTGGGGCCTCCCCGAGCTCCAAC
  CCGCTGCGCCCTCCTCATCAGCCGCTCAGCTGCCCTGGGGCGAGAGCTGGGGGGAAGAAGCAGACACTCC
  TGCATGTCTTTCTGCTTCTGGGGTGTGGTTCCAGAACCGCAGGACCAAGTGGCGGAAGAAGAGCGCCCTG
  GAGCCCTCGTCCTCCACGCCCCGGGCCCCGGGCGGCGCGGGTGCAGGCGCAGGCGGGGACCGCGCACCCT
  CGGAGAACGAGGACGACGAGTACAACAAGCCGCTGGACCCCGACTCGGACGACGAGAAGATCCGCCTGCT
  GCTGCGCAAGCACCGCGCCGCCTTCTCGGTGCTCAGCCTGGGAGCGCACAGCGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_152568
• ORF Size: 408 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_152568.3, NP_689781.1
• RefSeq Size: 1683
• RefSeq ORF: 408
• Locus ID: 157848
• Gene Summary: The NKX family of homeodomain proteins controls numerous developmental processes. Members of the NKX6 subfamily, including NKX6-3, are involved in development of the central nervous system (CNS), gastrointestinal tract, and pancreas (Alanentalo et al., 2006 [PubMed 16326147]). [supplied by OMIM, Mar 2008]