nkx6.3 (NKX6-3) (NM_152568) Human Untagged Clone
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NKX6-3 |
Synonyms | NKX6.3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_152568, the custom clone sequence may differ by one or more nucleotides
ATGCAGCAGGGGCAGCTGGCACCTGGGTCTAGGCTTTGCTCAGGGCCCTGGGGCCTCCCCGAGCTCCAAC CCGCTGCGCCCTCCTCATCAGCCGCTCAGCTGCCCTGGGGCGAGAGCTGGGGGGAAGAAGCAGACACTCC TGCATGTCTTTCTGCTTCTGGGGTGTGGTTCCAGAACCGCAGGACCAAGTGGCGGAAGAAGAGCGCCCTG GAGCCCTCGTCCTCCACGCCCCGGGCCCCGGGCGGCGCGGGTGCAGGCGCAGGCGGGGACCGCGCACCCT CGGAGAACGAGGACGACGAGTACAACAAGCCGCTGGACCCCGACTCGGACGACGAGAAGATCCGCCTGCT GCTGCGCAAGCACCGCGCCGCCTTCTCGGTGCTCAGCCTGGGAGCGCACAGCGTCTGA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_152568 |
ORF Size | 408 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_152568.3, NP_689781.1 |
RefSeq Size | 1683 |
RefSeq ORF | 408 |
Locus ID | 157848 |
Gene Summary | The NKX family of homeodomain proteins controls numerous developmental processes. Members of the NKX6 subfamily, including NKX6-3, are involved in development of the central nervous system (CNS), gastrointestinal tract, and pancreas (Alanentalo et al., 2006 [PubMed 16326147]). [supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215354 | NKX6 (Myc-DDK-tagged)-Human NK6 homeobox 3 (NKX6-3) |
USD 98.00 |
|
RG215354 | NKX6 (GFP-tagged) - Human NK6 homeobox 3 (NKX6-3) |
USD 460.00 |
|
RC215354L1 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), Myc-DDK-tagged |
USD 768.00 |
|
RC215354L2 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), mGFP tagged |
USD 620.00 |
|
RC215354L3 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), Myc-DDK-tagged |
USD 620.00 |
|
RC215354L4 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review